Result : EXP00204

Protein Information

• Protein name: EXP00204
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 3182489
• Right: 3182539
• Strand: +
• Nucleotide Sequence: ATGATGATCATCAGTTATTTTGACGATCTGCCTGAAGGTGAAGATTTATAA
• Sequence: MMIISYFDDLPEGEDL
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 16

Conservation Analysis

No. of Species: 5

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3928711	3928761	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	3182489	3182539	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	3175624	3175674	+	NC_004337.2	Shigella flexneri 2a str. 301
4	643069	643119	+	NZ_CP061527.1	Shigella dysenteriae
5	3174707	3174757	+	NZ_AP014857.1	Escherichia albertii
6	3708916	3708966	+	NZ_LR134340.1	Escherichia marmotae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF02321.20	0.6	3	2893.0	same-strand	Outer membrane efflux protein
2	PF06693.13	0.6	3	2074.0	same-strand	Protein of unknown function (DUF1190)
3	PF03738.16	1.0	5	908.0	same-strand	Glutathionylspermidine synthase preATP-grasp
4	PF02900.20	0.8	4	55	opposite-strand	Catalytic LigB subunit of aromatic ring-opening dioxygenase
5	PF00926.21	0.6	3	1274.0	opposite-strand	3,4-dihydroxy-2-butanone 4-phosphate synthase
6	PF04380.15	0.6	3	2301.0	same-strand	Membrane fusogenic activity