Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00202 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 507241 |
Right | 507330 |
Strand | + |
Nucleotide Sequence | ATGAAATTCCTCTTTGACGGGCCAATAGCGATATTGGCCATTTTTTTAGCGCAACATTTGCGGCAAATTCCCTTCTCCATACAGGTGTAG |
Sequence | MKFLFDGPIAILAIFLAQHLRQIPFSIQV |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 29 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 507241 | 507330 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 443662 | 443751 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
3 | 525749 | 525838 | + | NZ_AP014857.1 | Escherichia albertii |
4 | 3188749 | 3188838 | + | NZ_CP061527.1 | Shigella dysenteriae |
5 | 4097014 | 4097103 | + | NZ_CP057657.1 | Escherichia fergusonii |
6 | 1152083 | 1152166 | + | NZ_LR134340.1 | Escherichia marmotae |
7 | 602737 | 602826 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
8 | 4548442 | 4548531 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
9 | 3992237 | 3992320 | - | NZ_CP041247.1 | Raoultella electrica |
10 | 3016300 | 3016383 | + | NZ_CP026047.1 | Raoultella planticola |
11 | 4336194 | 4336277 | - | NZ_CP050508.1 | Raoultella terrigena |
12 | 1124537 | 1124626 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
13 | 4392768 | 4392857 | - | NZ_CP045205.1 | Citrobacter telavivensis |
14 | 1157287 | 1157376 | + | NZ_CP009756.1 | Enterobacter cloacae |
15 | 1322780 | 1322869 | + | NZ_CP043318.1 | Enterobacter chengduensis |
16 | 4225791 | 4225874 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
17 | 3420641 | 3420730 | - | NZ_CP045845.1 | Kluyvera intermedia |
18 | 1082438 | 1082521 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
19 | 1133030 | 1133113 | + | NZ_AP022508.1 | Enterobacter bugandensis |
20 | 3471171 | 3471266 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00999.23 | 0.9 | 18 | 4019.0 | opposite-strand | Sodium/hydrogen exchanger family |
2 | PF02254.20 | 0.9 | 18 | 4019.0 | opposite-strand | TrkA-N domain |
3 | PF02872.20 | 1.0 | 20 | 754.5 | same-strand | 5'-nucleotidase, C-terminal domain |
4 | PF00149.30 | 1.0 | 20 | 754.5 | same-strand | Calcineurin-like phosphoesterase |
5 | PF04073.17 | 1.0 | 20 | 157.0 | opposite-strand | Aminoacyl-tRNA editing domain |
6 | PF01963.19 | 1.0 | 20 | -44.0 | opposite-strand | TraB/PrgY/gumN family |
7 | PF00122.22 | 0.95 | 19 | 899 | opposite-strand | E1-E2 ATPase |
8 | PF00702.28 | 0.95 | 19 | 899 | opposite-strand | haloacid dehalogenase-like hydrolase |
9 | PF00403.28 | 0.95 | 19 | 899 | opposite-strand | Heavy-metal-associated domain |
10 | PF07690.18 | 0.6 | 12 | 2578.0 | opposite-strand | Major Facilitator Superfamily |