Result : EXP00201
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00201 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3817822 |
| Right | 3817911 |
| Strand | + |
| Nucleotide Sequence | ATGGTCAGCAAGACAACTTGGGAAACTACTGGGTTATTCAGAGTATCGTCACTTTATACCTGTATTAACGCGCGCCAAAGAAGCCTGTGA |
| Sequence | MVSKTTWETTGLFRVSSLYTCINARQRSL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3817822 | 3817911 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3788136 | 3788225 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00440.25 | 1.0 | 2 | 2732.5 | same-strand | Bacterial regulatory proteins, tetR family |
| 2 | PF01138.23 | 1.0 | 2 | 1273.0 | opposite-strand | 3' exoribonuclease family, domain 1 |
| 3 | PF03725.17 | 1.0 | 2 | 1273.0 | opposite-strand | 3' exoribonuclease family, domain 2 |
| 4 | PF03755.15 | 1.0 | 2 | 283.0 | same-strand | YicC-like family, N-terminal region |
| 5 | PF08340.13 | 1.0 | 2 | 283.0 | same-strand | Domain of unknown function (DUF1732) |
| 6 | PF02498.19 | 1.0 | 2 | -89.0 | same-strand | BRO family, N-terminal domain |
| 7 | PF03458.15 | 1.0 | 2 | 963.5 | same-strand | Glycine transporter |
| 8 | PF03120.18 | 1.0 | 2 | 1577.5 | opposite-strand | NAD-dependent DNA ligase OB-fold domain |
| 9 | PF00625.23 | 1.0 | 2 | 3517.5 | same-strand | Guanylate kinase |
| 10 | PF01192.24 | 1.0 | 2 | 4195.5 | same-strand | RNA polymerase Rpb6 |
| 11 | PF13328.8 | 1.0 | 2 | 4489.5 | same-strand | HD domain |
| 12 | PF04607.19 | 1.0 | 2 | 4489.5 | same-strand | Region found in RelA / SpoT proteins |
| 13 | PF02824.23 | 1.0 | 2 | 4489.5 | same-strand | TGS domain |
| 14 | PF13291.8 | 1.0 | 2 | 4489.5 | same-strand | ACT domain |
| 15 | PF01966.24 | 1.0 | 2 | 4489.5 | same-strand | HD domain |
++ More..