Result : EXP00199
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00199 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3922800 |
| Right | 3922871 |
| Strand | + |
| Nucleotide Sequence | ATGACATTTACACAACAAAAACCACCCATTGACATTTTTAATAATGTTTTAACAGCCAATGATGGTTCTTAG |
| Sequence | MTFTQQKPPIDIFNNVLTANDGS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4716369 | 4716440 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3922800 | 3922871 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3889684 | 3889755 | + | NZ_AP014857.1 | Escherichia albertii |
| 4 | 4248141 | 4248212 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00213.20 | 1.0 | 3 | 2397.0 | opposite-strand | ATP synthase delta (OSCP) subunit |
| 2 | PF00430.20 | 1.0 | 3 | 1912.0 | opposite-strand | ATP synthase B/B' CF(0) |
| 3 | PF00137.23 | 1.0 | 3 | 1611.0 | opposite-strand | ATP synthase subunit C |
| 4 | PF00119.22 | 1.0 | 3 | 749.0 | opposite-strand | ATP synthase A chain |
| 5 | PF03899.17 | 1.0 | 3 | 360.0 | opposite-strand | ATP synthase I chain |
| 6 | PF02527.17 | 1.0 | 3 | 186.0 | opposite-strand | rRNA small subunit methyltransferase G |
| 7 | PF01134.24 | 1.0 | 3 | 873.0 | opposite-strand | Glucose inhibited division protein A |
| 8 | PF13932.8 | 1.0 | 3 | 873.0 | opposite-strand | tRNA modifying enzyme MnmG/GidA C-terminal domain |
| 9 | PF00258.27 | 1.0 | 3 | 3141.0 | opposite-strand | Flavodoxin |
| 10 | PF01037.23 | 1.0 | 3 | 3674.0 | opposite-strand | Lrp/AsnC ligand binding domain |
| 11 | PF13412.8 | 1.0 | 3 | 3674.0 | opposite-strand | Winged helix-turn-helix DNA-binding |
| 12 | PF13404.8 | 1.0 | 3 | 3674.0 | opposite-strand | AsnC-type helix-turn-helix domain |
| 13 | PF03590.17 | 1.0 | 3 | 4284.0 | same-strand | Aspartate-ammonia ligase |
++ More..