Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00198 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 4478816 |
Right | 4478893 |
Strand | + |
Nucleotide Sequence | TTGAAGATCCTAACGGCGAAGATGGCGACGATGAAGATTTTGTCGATGAAGACGATGACGGAGTTCGCCACTAATTAA |
Sequence | LKILTAKMATMKILSMKTMTEFATN |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 25 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4478816 | 4478893 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 4408576 | 4408653 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
3 | 5334440 | 5334517 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
4 | 3980523 | 3980600 | - | NZ_CP061527.1 | Shigella dysenteriae |
5 | 514754 | 514831 | + | NZ_LR134340.1 | Escherichia marmotae |
6 | 4523500 | 4523577 | + | NZ_AP014857.1 | Escherichia albertii |
7 | 3436366 | 3436443 | + | NZ_CP057657.1 | Escherichia fergusonii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04074.14 | 0.83 | 5 | 3217.0 | same-strand | YhcH/YjgK/YiaL |
2 | PF00185.26 | 1.0 | 6 | 505.0 | opposite-strand | Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
3 | PF02729.23 | 1.0 | 6 | 505.0 | opposite-strand | Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
4 | PF06877.13 | 1.0 | 6 | -73 | same-strand | Regulator of ribonuclease activity B |
5 | PF00583.27 | 1.0 | 6 | 42 | opposite-strand | Acetyltransferase (GNAT) family |
6 | PF13508.9 | 1.0 | 6 | 42 | opposite-strand | Acetyltransferase (GNAT) domain |
7 | PF13302.9 | 1.0 | 6 | 42 | opposite-strand | Acetyltransferase (GNAT) domain |
8 | PF05987.15 | 0.83 | 5 | 738.0 | same-strand | Bacterial protein of unknown function (DUF898) |
9 | PF00133.24 | 0.83 | 5 | 1988.5 | opposite-strand | tRNA synthetases class I (I, L, M and V) |
10 | PF08264.15 | 0.83 | 5 | 1988.5 | opposite-strand | Anticodon-binding domain of tRNA ligase |
11 | PF10458.11 | 0.83 | 5 | 1988.5 | opposite-strand | Valyl tRNA synthetase tRNA binding arm |
12 | PF04364.15 | 0.83 | 5 | 4843.5 | opposite-strand | DNA polymerase III chi subunit, HolC |
13 | PF00883.23 | 0.83 | 5 | 5594.0 | opposite-strand | Cytosol aminopeptidase family, catalytic domain |
14 | PF02789.19 | 0.83 | 5 | 5594.0 | opposite-strand | Cytosol aminopeptidase family, N-terminal domain |