Result : EXP00198
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00198 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4478816 |
| Right | 4478893 |
| Strand | + |
| Nucleotide Sequence | TTGAAGATCCTAACGGCGAAGATGGCGACGATGAAGATTTTGTCGATGAAGACGATGACGGAGTTCGCCACTAATTAA |
| Sequence | LKILTAKMATMKILSMKTMTEFATN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4478816 | 4478893 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4408576 | 4408653 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 5334440 | 5334517 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 3980523 | 3980600 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 514754 | 514831 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 4523500 | 4523577 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 3436366 | 3436443 | + | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04074.14 | 0.83 | 5 | 3217.0 | same-strand | YhcH/YjgK/YiaL |
| 2 | PF00185.26 | 1.0 | 6 | 505.0 | opposite-strand | Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
| 3 | PF02729.23 | 1.0 | 6 | 505.0 | opposite-strand | Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
| 4 | PF06877.13 | 1.0 | 6 | -73 | same-strand | Regulator of ribonuclease activity B |
| 5 | PF00583.27 | 1.0 | 6 | 42 | opposite-strand | Acetyltransferase (GNAT) family |
| 6 | PF13508.9 | 1.0 | 6 | 42 | opposite-strand | Acetyltransferase (GNAT) domain |
| 7 | PF13302.9 | 1.0 | 6 | 42 | opposite-strand | Acetyltransferase (GNAT) domain |
| 8 | PF05987.15 | 0.83 | 5 | 738.0 | same-strand | Bacterial protein of unknown function (DUF898) |
| 9 | PF00133.24 | 0.83 | 5 | 1988.5 | opposite-strand | tRNA synthetases class I (I, L, M and V) |
| 10 | PF08264.15 | 0.83 | 5 | 1988.5 | opposite-strand | Anticodon-binding domain of tRNA ligase |
| 11 | PF10458.11 | 0.83 | 5 | 1988.5 | opposite-strand | Valyl tRNA synthetase tRNA binding arm |
| 12 | PF04364.15 | 0.83 | 5 | 4843.5 | opposite-strand | DNA polymerase III chi subunit, HolC |
| 13 | PF00883.23 | 0.83 | 5 | 5594.0 | opposite-strand | Cytosol aminopeptidase family, catalytic domain |
| 14 | PF02789.19 | 0.83 | 5 | 5594.0 | opposite-strand | Cytosol aminopeptidase family, N-terminal domain |
++ More..