Result : EXP00197
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00197 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 837487 |
| Right | 837549 |
| Strand | + |
| Nucleotide Sequence | ATGAGGGTTAGAGCATATGCGTCTGTCGGCAAACAGACAGGGAAATACTTGTGCTGGACGTAG |
| Sequence | MRVRAYASVGKQTGKYLCWT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 837487 | 837549 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 780112 | 780174 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2867936 | 2867998 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1307644 | 1307706 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 961928 | 961990 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 835275 | 835337 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00270.31 | 0.8 | 4 | 5193 | same-strand | DEAD/DEAH box helicase |
| 2 | PF00271.33 | 0.8 | 4 | 5193 | same-strand | Helicase conserved C-terminal domain |
| 3 | PF04851.17 | 1.0 | 5 | 2270 | same-strand | Type III restriction enzyme, res subunit |
| 4 | PF13245.8 | 0.8 | 4 | 5193 | same-strand | AAA domain |
| 5 | PF13307.8 | 1.0 | 5 | 2267.0 | same-strand | Helicase C-terminal domain |
| 6 | PF02885.19 | 1.0 | 5 | 1277.0 | same-strand | Glycosyl transferase family, helical bundle domain |
| 7 | PF00591.23 | 0.8 | 4 | 1277 | same-strand | Glycosyl transferase family, a/b domain |
| 8 | PF02615.16 | 1.0 | 5 | 51.0 | same-strand | Malate/L-lactate dehydrogenase |
| 9 | PF07338.15 | 1.0 | 5 | 125.5 | opposite-strand | Protein of unknown function (DUF1471) |
| 10 | PF01258.19 | 1.0 | 5 | 641.0 | opposite-strand | Prokaryotic dksA/traR C4-type zinc finger |
| 11 | PF18331.3 | 0.8 | 4 | 981 | opposite-strand | PKHD-type hydroxylase C-terminal domain |
| 12 | PF13640.8 | 0.8 | 4 | 981 | opposite-strand | 2OG-Fe(II) oxygenase superfamily |
| 13 | PF00593.26 | 0.6 | 3 | 1700.5 | opposite-strand | TonB dependent receptor |
++ More..