Result : EXP00196
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00196 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 778077 |
| Right | 778148 |
| Strand | + |
| Nucleotide Sequence | ATGTTGCTTATCAACTTGTTGACACTGGCGGCGCACCGGGTACTGTACTTGCTCAGAACTCGTACAAAGTGA |
| Sequence | MLLINLLTLAAHRVLYLLRTRTK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 862503 | 862574 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 778077 | 778148 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 579108 | 579179 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2963879 | 2963950 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2220781 | 2220852 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 6 | 2995148 | 2995219 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03061.24 | 1.0 | 5 | 2873.0 | same-strand | Thioesterase superfamily |
| 2 | PF13279.8 | 1.0 | 5 | 2873.0 | same-strand | Thioesterase-like superfamily |
| 3 | PF01618.18 | 1.0 | 5 | 2184.0 | same-strand | MotA/TolQ/ExbB proton channel family |
| 4 | PF02472.18 | 1.0 | 5 | 1752.0 | same-strand | Biopolymer transport protein ExbD/TolR |
| 5 | PF06519.13 | 0.8 | 4 | 470 | same-strand | TolA C-terminal |
| 6 | PF07676.14 | 1.0 | 5 | -71.0 | same-strand | WD40-like Beta Propeller Repeat |
| 7 | PF04052.15 | 1.0 | 5 | -71.0 | same-strand | TolB amino-terminal domain |
| 8 | PF00691.22 | 1.0 | 5 | 919.0 | same-strand | OmpA family |
| 9 | PF13174.8 | 1.0 | 5 | 1450.0 | same-strand | Tetratricopeptide repeat |
| 10 | PF16331.7 | 1.0 | 5 | 1450.0 | same-strand | TolA binding protein trimerisation |
| 11 | PF13432.8 | 1.0 | 5 | 1450.0 | same-strand | Tetratricopeptide repeat |
| 12 | PF02445.18 | 1.0 | 5 | 3434.5 | same-strand | Quinolinate synthetase A protein |
| 13 | PF04973.14 | 1.0 | 5 | 4509.0 | same-strand | Nicotinamide mononucleotide transporter |
| 14 | PF09600.12 | 0.6 | 3 | 3430 | same-strand | Cyd operon protein YbgE (Cyd oper YbgE) |
++ More..