Result : EXP00195

Protein Information

• Protein name: EXP00195
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 324461
• Right: 324502
• Strand: +
• Nucleotide Sequence: ATGAAGTCTGGACATAAACCTGAAGAAGGCATACGAGGTTGA
• Sequence: MKSGHKPEEGIRG
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 13

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	367176	367217	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	324461	324502	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	275064	275105	-	NC_004337.2	Shigella flexneri 2a str. 301

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF02754.18	1.0	2	2134	same-strand	Cysteine-rich domain
2	PF02589.17	1.0	2	352.0	same-strand	LUD domain
3	PF13183.8	1.0	2	696	same-strand	4Fe-4S dicluster domain
4	PF11870.10	1.0	2	696	same-strand	Domain of unknown function (DUF3390)
5	PF13237.8	1.0	2	696	same-strand	4Fe-4S dicluster domain
6	PF13534.8	1.0	2	696	same-strand	4Fe-4S dicluster domain
7	PF13187.8	1.0	2	696	same-strand	4Fe-4S dicluster domain
8	PF12838.9	1.0	2	696	same-strand	4Fe-4S dicluster domain
9	PF20130.1	1.0	2	194	opposite-strand	Family of unknown function (DUF6520)