Result : EXP00194
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00194 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 500018 |
| Right | 500116 |
| Strand | + |
| Nucleotide Sequence | ATGAAAATGCGATCCCGCCTGCTGATATTGAAACTGGCTGCGTCTCGCGCGCTCCCGTCAGATTGTGTTAACATTCGCCGCTCAGTTAACCACCCGTAA |
| Sequence | MKMRSRLLILKLAASRALPSDCVNIRRSVNHP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 32 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 565810 | 565908 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 500018 | 500116 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 436439 | 436537 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3180086 | 3180184 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1144872 | 1144970 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 517931 | 518029 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 3285033 | 3285122 | - | NZ_CP017940.1 | Phyllobacterium zundukense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13662.8 | 0.67 | 4 | 4931 | same-strand | Toprim domain |
| 2 | PF02132.17 | 0.67 | 4 | 4931 | same-strand | RecR protein |
| 3 | PF01751.24 | 0.67 | 4 | 4931 | same-strand | Toprim domain |
| 4 | PF00183.20 | 0.83 | 5 | 2933.0 | same-strand | Hsp90 protein |
| 5 | PF02518.28 | 0.83 | 5 | 2933.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 6 | PF13589.8 | 0.83 | 5 | 2933.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 7 | PF00406.24 | 0.83 | 5 | 2095.0 | same-strand | Adenylate kinase |
| 8 | PF13207.8 | 0.83 | 5 | 2095.0 | same-strand | AAA domain |
| 9 | PF05191.16 | 0.83 | 5 | 2095.0 | same-strand | Adenylate kinase, active site lid |
| 10 | PF00762.21 | 0.83 | 5 | 1001.0 | same-strand | Ferrochelatase |
| 11 | PF07859.15 | 0.67 | 4 | 45 | opposite-strand | alpha/beta hydrolase fold |
| 12 | PF00999.23 | 0.83 | 5 | 1446.0 | opposite-strand | Sodium/hydrogen exchanger family |
| 13 | PF02254.20 | 0.83 | 5 | 1446.0 | opposite-strand | TrkA-N domain |
| 14 | PF02872.20 | 0.67 | 4 | 4798 | same-strand | 5'-nucleotidase, C-terminal domain |
| 15 | PF00149.30 | 0.67 | 4 | 4798 | same-strand | Calcineurin-like phosphoesterase |
++ More..