Result : EXP00193
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00193 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 89428 |
| Right | 89487 |
| Strand | + |
| Nucleotide Sequence | ATGAGGGATTTTTTCTTACAGCTATTCATAACGTTAATTTGCTTCGCACGTTGGACGTAA |
| Sequence | MRDFFLQLFITLICFARWT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 89428 | 89487 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 88046 | 88105 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 94034 | 94093 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 90751 | 90810 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00682.21 | 0.67 | 2 | 5898 | opposite-strand | HMGL-like |
| 2 | PF08502.12 | 0.67 | 2 | 5898 | opposite-strand | LeuA allosteric (dimerisation) domain |
| 3 | PF00126.29 | 1.0 | 3 | 4116.5 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 4 | PF03466.22 | 1.0 | 3 | 4116.5 | same-strand | LysR substrate binding domain |
| 5 | PF02776.20 | 1.0 | 3 | 2074.5 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 6 | PF02775.23 | 1.0 | 3 | 2074.5 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 7 | PF00205.24 | 1.0 | 3 | 2074.5 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 8 | PF10369.11 | 1.0 | 3 | 1580.5 | same-strand | Small subunit of acetolactate synthase |
| 9 | PF13710.8 | 1.0 | 3 | 1580.5 | same-strand | ACT domain |
| 10 | PF01842.27 | 1.0 | 3 | 1580.5 | same-strand | ACT domain |
| 11 | PF13291.8 | 1.0 | 3 | 1580.5 | same-strand | ACT domain |
| 12 | PF00356.23 | 1.0 | 3 | 396.5 | same-strand | Bacterial regulatory proteins, lacI family |
| 13 | PF00532.23 | 1.0 | 3 | 396.5 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 14 | PF13377.8 | 1.0 | 3 | 396.5 | same-strand | Periplasmic binding protein-like domain |
| 15 | PF13407.8 | 1.0 | 3 | 396.5 | same-strand | Periplasmic binding protein domain |
| 16 | PF02381.20 | 1.0 | 3 | 147.0 | same-strand | MraZ protein, putative antitoxin-like |
| 17 | PF01795.21 | 1.0 | 3 | 607.0 | same-strand | MraW methylase family |
| 18 | PF04999.15 | 1.0 | 3 | 1545.0 | same-strand | Cell division protein FtsL |
| 19 | PF00905.24 | 1.0 | 3 | 1926.0 | same-strand | Penicillin binding protein transpeptidase domain |
| 20 | PF03717.17 | 1.0 | 3 | 1926.0 | same-strand | Penicillin-binding Protein dimerisation domain |
| 21 | PF08245.14 | 1.0 | 3 | 3679.0 | same-strand | Mur ligase middle domain |
| 22 | PF02875.23 | 1.0 | 3 | 3679.0 | same-strand | Mur ligase family, glutamate ligase domain |
| 23 | PF01225.27 | 1.0 | 3 | 3679.0 | same-strand | Mur ligase family, catalytic domain |
++ More..