Result : EXP00192
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00192 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3211088 |
| Right | 3211138 |
| Strand | + |
| Nucleotide Sequence | TTGCTAAAAATCGGGGCCTATGGCTGGACGAATCCCACGCGTATTCATTAA |
| Sequence | LLKIGAYGWTNPTRIH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3950747 | 3950797 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3202066 | 3202116 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 3211088 | 3211138 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 3200125 | 3200175 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 2101771 | 2101821 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 3726402 | 3726452 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 3810379 | 3810432 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 689952 | 690005 | - | NZ_CP050508.1 | Raoultella terrigena |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00814.27 | 1.0 | 7 | 545.0 | opposite-strand | tRNA N6-adenosine threonylcarbamoyltransferase |
| 2 | PF01165.22 | 1.0 | 7 | 92.0 | same-strand | Ribosomal protein S21 |
| 3 | PF08275.13 | 1.0 | 7 | -31.0 | same-strand | DNA primase catalytic core, N-terminal domain |
| 4 | PF01807.22 | 1.0 | 7 | -31.0 | same-strand | CHC2 zinc finger |
| 5 | PF08278.13 | 1.0 | 7 | -31.0 | same-strand | DNA primase DnaG DnaB-binding |
| 6 | PF13155.8 | 1.0 | 7 | -31.0 | same-strand | Toprim-like |
| 7 | PF13662.8 | 1.0 | 7 | -31.0 | same-strand | Toprim domain |
| 8 | PF10410.11 | 1.0 | 7 | -31.0 | same-strand | DnaB-helicase binding domain of primase |
| 9 | PF01751.24 | 1.0 | 7 | -31.0 | same-strand | Toprim domain |
| 10 | PF13362.8 | 1.0 | 7 | -31.0 | same-strand | Toprim domain |
| 11 | PF04546.15 | 1.0 | 7 | 1909.0 | same-strand | Sigma-70, non-essential region |
| 12 | PF03979.16 | 1.0 | 7 | 1909.0 | same-strand | Sigma-70 factor, region 1.1 |
| 13 | PF04539.18 | 1.0 | 7 | 1909.0 | same-strand | Sigma-70 region 3 |
| 14 | PF04542.16 | 1.0 | 7 | 1909.0 | same-strand | Sigma-70 region 2 |
| 15 | PF04545.18 | 1.0 | 7 | 1909.0 | same-strand | Sigma-70, region 4 |
| 16 | PF00140.22 | 1.0 | 7 | 1909.0 | same-strand | Sigma-70 factor, region 1.2 |
| 17 | PF03167.21 | 0.86 | 6 | 3829 | opposite-strand | Uracil DNA glycosylase superfamily |
++ More..