Result : EXP00189

Protein Information

• Protein name: EXP00189
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 850254
• Right: 850298
• Strand: +
• Nucleotide Sequence: ATGAATGACAGGGAAAACATGCGTAATACTTACGCAGTTCTCTGA
• Sequence: MNDRENMRNTYAVL
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 14

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	974561	974605	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	850254	850298	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	794316	794360	+	NC_004337.2	Shigella flexneri 2a str. 301
4	2884196	2884240	+	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00005.29	0.67	2	3791	opposite-strand	ABC transporter
2	PF00528.24	1.0	3	3135.0	opposite-strand	Binding-protein-dependent transport system inner membrane component
3	PF00497.22	1.0	3	2250.0	opposite-strand	Bacterial extracellular solute-binding proteins, family 3
4	PF00210.26	1.0	3	1343.0	opposite-strand	Ferritin-like domain
5	PF00892.22	1.0	3	157.0	opposite-strand	EamA-like transporter family
6	PF13505.8	1.0	3	152.0	same-strand	Outer membrane protein beta-barrel domain
7	PF00884.25	1.0	3	716.0	opposite-strand	Sulfatase
8	PF01325.21	1.0	3	2885.0	same-strand	Iron dependent repressor, N-terminal DNA binding domain
9	PF03600.18	0.67	2	3349	same-strand	Citrate transporter