Result : EXP00184

Protein Information

• Protein name: EXP00184
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 253239
• Right: 253286
• Strand: +
• Nucleotide Sequence: ATGACAAATCCTTTATCAATGACTCTTTGCAGACCTTTCCAGGATTAA
• Sequence: MTNPLSMTLCRPFQD
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 6

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	291126	291173	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	323987	324034	+	NZ_AP014857.1	Escherichia albertii
3	253239	253286	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
4	300644	300691	+	NC_004337.2	Shigella flexneri 2a str. 301
5	3145509	3145556	+	NZ_CP061527.1	Shigella dysenteriae
6	1792083	1792130	-	NZ_CP057657.1	Escherichia fergusonii
7	907139	907186	+	NZ_LR134340.1	Escherichia marmotae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_AP014857.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00691.22	1.0	6	1718	same-strand	OmpA family
2	PF00817.22	1.0	6	527	same-strand	impB/mucB/samB family
3	PF11799.10	1.0	6	527	same-strand	impB/mucB/samB family C-terminal domain
4	PF11798.10	1.0	6	527	same-strand	IMS family HHH motif
5	PF13673.9	0.83	5	78.0	same-strand	Acetyltransferase (GNAT) domain
6	PF13508.9	0.83	5	78.0	same-strand	Acetyltransferase (GNAT) domain
7	PF01546.30	1.0	6	1897	opposite-strand	Peptidase family M20/M25/M40
8	PF07687.16	1.0	6	1897	opposite-strand	Peptidase dimerisation domain
9	PF00472.22	0.67	4	1227.5	same-strand	RF-1 domain