Result : EXP00177
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00177 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1424140 |
| Right | 1424193 |
| Strand | + |
| Nucleotide Sequence | TTGATGATGTTAGTTCATTACCTCGGGCATATTTGTACTATCGGTCACAGTTAA |
| Sequence | LMMLVHYLGHICTIGHS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1424140 | 1424193 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2326242 | 2326295 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02386.18 | 1.0 | 2 | -53.0 | same-strand | Cation transport protein |
| 2 | PF02195.20 | 1.0 | 2 | 1184.0 | same-strand | ParB-like nuclease domain |
++ More..