Result : EXP00176
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00176 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4608237 |
| Right | 4608320 |
| Strand | + |
| Nucleotide Sequence | TTGAACAACGCGCCCACGCCTTTCCGTGGAGTGAAAAAACGTTTGCCAGCAACCAGGGCGAGCGTTATCTCAACTTTCAGTTAA |
| Sequence | LNNAPTPFRGVKKRLPATRASVISTFS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 36
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4608237 | 4608320 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 5466410 | 5466493 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 4575108 | 4575191 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3647448 | 3647531 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3500305 | 3500388 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 595126 | 595209 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 4625359 | 4625442 | + | NZ_AP014857.1 | Escherichia albertii |
| 8 | 2709312 | 2709395 | - | NZ_CP038469.1 | Citrobacter tructae |
| 9 | 3408095 | 3408178 | + | NZ_CP033744.1 | Citrobacter freundii |
| 10 | 1648126 | 1648209 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 11 | 649719 | 649790 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 12 | 3190655 | 3190738 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 13 | 4812721 | 4812804 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 14 | 670144 | 670227 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 15 | 3391559 | 3391630 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 16 | 615799 | 615870 | + | NC_015968.1 | Enterobacter soli |
| 17 | 2563286 | 2563363 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 18 | 881726 | 881803 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 19 | 5249409 | 5249480 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 20 | 724730 | 724807 | - | NZ_LT615367.1 | Dickeya aquatica |
| 21 | 387277 | 387360 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 22 | 1774439 | 1774528 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 23 | 655089 | 655160 | + | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 24 | 4574229 | 4574306 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 25 | 684827 | 684904 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 26 | 4175306 | 4175389 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 27 | 3524801 | 3524872 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 28 | 2940560 | 2940643 | - | NZ_CP067057.1 | Rahnella aceris |
| 29 | 2785415 | 2785486 | - | NZ_CP027107.1 | Cronobacter sakazakii |
| 30 | 3672230 | 3672307 | + | NZ_CP042220.2 | Dickeya poaceiphila |
| 31 | 645072 | 645143 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 32 | 760327 | 760398 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 33 | 1880901 | 1880972 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 34 | 3959542 | 3959625 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 35 | 3287127 | 3287210 | - | NZ_CP023567.1 | Erwinia pyrifoliae |
| 36 | 698905 | 698982 | - | NC_014500.1 | Dickeya dadantii 3937 |
| 37 | 5145062 | 5145145 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP057657.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07256.14 | 0.89 | 32 | 2130 | same-strand | Protein of unknown function (DUF1435) |
| 2 | PF05175.16 | 1.0 | 36 | 538 | opposite-strand | Methyltransferase small domain |
| 3 | PF08468.13 | 1.0 | 36 | 538 | opposite-strand | Methyltransferase small domain N-terminal |
| 4 | PF13649.8 | 0.94 | 34 | 537 | opposite-strand | Methyltransferase domain |
| 5 | PF08242.14 | 0.83 | 30 | 537 | opposite-strand | Methyltransferase domain |
| 6 | PF08241.14 | 0.72 | 26 | 537 | opposite-strand | Methyltransferase domain |
| 7 | PF03603.15 | 1.0 | 36 | 21 | same-strand | DNA polymerase III psi subunit |
| 8 | PF00583.27 | 0.75 | 27 | -83.0 | same-strand | Acetyltransferase (GNAT) family |
| 9 | PF13508.9 | 0.83 | 30 | -83 | same-strand | Acetyltransferase (GNAT) domain |
| 10 | PF00702.28 | 0.75 | 27 | 326.0 | same-strand | haloacid dehalogenase-like hydrolase |
| 11 | PF13242.8 | 0.72 | 26 | 326 | same-strand | HAD-hyrolase-like |
| 12 | PF16658.7 | 0.72 | 26 | 1099 | same-strand | Class II release factor RF3, C-terminal domain |
| 13 | PF00009.29 | 0.72 | 26 | 1099 | same-strand | Elongation factor Tu GTP binding domain |
| 14 | PF03144.27 | 0.72 | 26 | 1099 | same-strand | Elongation factor Tu domain 2 |
| 15 | PF01926.25 | 0.72 | 26 | 1099 | same-strand | 50S ribosome-binding GTPase |
| 16 | PF14492.8 | 0.72 | 26 | 1099 | same-strand | Elongation Factor G, domain III |
| 17 | PF04972.19 | 0.67 | 24 | 3075 | same-strand | BON domain |
| 18 | PF07043.15 | 0.69 | 25 | 3776.5 | same-strand | Protein of unknown function (DUF1328) |
| 19 | PF13420.9 | 0.64 | 23 | -83 | same-strand | Acetyltransferase (GNAT) domain |
++ More..