Result : EXP00175
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00175 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2177294 |
| Right | 2177341 |
| Strand | + |
| Nucleotide Sequence | ATGAAAATTATTCGAGGAGTGAAAGGCAAAAAAACGGCCTCCCGATAG |
| Sequence | MKIIRGVKGKKTASR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2177294 | 2177341 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2182971 | 2183018 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 1622981 | 1623028 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02302.19 | 0.67 | 2 | 2728.0 | opposite-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
| 2 | PF00359.24 | 0.67 | 2 | 2245.0 | opposite-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
| 3 | PF08013.13 | 0.67 | 2 | 973.0 | opposite-strand | D-tagatose-1,6-bisphosphate aldolase subunit GatZ/KbaZ-like |
| 4 | PF01116.22 | 1.0 | 3 | 90 | opposite-strand | Fructose-bisphosphate aldolase class-II |
| 5 | PF01791.11 | 1.0 | 3 | 171 | opposite-strand | DeoC/LacD family aldolase |
| 6 | PF03825.18 | 0.67 | 2 | 1441.0 | same-strand | Nucleoside H+ symporter |
| 7 | PF12832.9 | 0.67 | 2 | 1441.0 | same-strand | MFS 1 like family |
| 8 | PF07690.18 | 0.67 | 2 | 1441.0 | same-strand | Major Facilitator Superfamily |
| 9 | PF03747.16 | 0.67 | 2 | 2715.0 | same-strand | ADP-ribosylglycohydrolase |
| 10 | PF00294.26 | 1.0 | 3 | 3677 | same-strand | pfkB family carbohydrate kinase |
| 11 | PF07702.15 | 1.0 | 3 | 4616 | opposite-strand | UTRA domain |
| 12 | PF00392.23 | 0.67 | 2 | 4655.0 | opposite-strand | Bacterial regulatory proteins, gntR family |
++ More..