Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00174 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 4439322 |
Right | 4439354 |
Strand | + |
Nucleotide Sequence | ATGTGCTATTTATCGAATTTCCCGCAAGTGTGA |
Sequence | MCYLSNFPQV |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 10 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 5294912 | 5294944 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 4439322 | 4439354 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 4448626 | 4448658 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 3819988 | 3820020 | - | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01638.19 | 0.67 | 2 | 4826 | same-strand | HxlR-like helix-turn-helix |
2 | PF02872.20 | 0.67 | 2 | 2757 | opposite-strand | 5'-nucleotidase, C-terminal domain |
3 | PF00149.30 | 0.67 | 2 | 2757 | opposite-strand | Calcineurin-like phosphoesterase |
4 | PF00459.27 | 0.67 | 2 | 1827 | same-strand | Inositol monophosphatase family |
5 | PF09695.12 | 1.0 | 3 | 60.0 | opposite-strand | Bacterial protein of unknown function (YtfJ HI0045) |
6 | PF06526.14 | 1.0 | 3 | 233.0 | same-strand | Protein of unknown function (DUF1107) |
7 | PF01595.22 | 1.0 | 3 | 518.0 | opposite-strand | Cyclin M transmembrane N-terminal domain |
8 | PF03471.19 | 1.0 | 3 | 518.0 | opposite-strand | Transporter associated domain |
9 | PF01625.23 | 1.0 | 3 | 2184.0 | opposite-strand | Peptide methionine sulfoxide reductase |
10 | PF01103.25 | 1.0 | 3 | 3028.0 | same-strand | Omp85 superfamily domain |
11 | PF17243.4 | 1.0 | 3 | 3028.0 | same-strand | POTRA domain TamA domain 1 |
12 | PF04357.15 | 1.0 | 3 | 4758.0 | same-strand | TamB, inner membrane protein subunit of TAM complex |