Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00173 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 922352 |
Right | 922414 |
Strand | + |
Nucleotide Sequence | ATGAGACAGAAGAGCTATGCGACTGCCGCTTCTACTTCGACGGGCACAATAACACTGGCGTGA |
Sequence | MRQKSYATAASTSTGTITLA |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 20 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1053428 | 1053490 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 922352 | 922414 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 873665 | 873727 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 1419156 | 1419218 | + | NZ_CP061527.1 | Shigella dysenteriae |
5 | 1571325 | 1571387 | + | NZ_LR134340.1 | Escherichia marmotae |
6 | 947553 | 947615 | + | NZ_AP014857.1 | Escherichia albertii |
7 | 371484 | 371546 | + | NZ_CP038469.1 | Citrobacter tructae |
8 | 878075 | 878137 | - | NZ_CP033744.1 | Citrobacter freundii |
9 | 4185053 | 4185115 | + | NZ_CP044098.1 | Citrobacter portucalensis |
10 | 3697522 | 3697581 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
11 | 3552247 | 3552306 | + | NZ_CP026047.1 | Raoultella planticola |
12 | 3527059 | 3527118 | - | NZ_CP041247.1 | Raoultella electrica |
13 | 3904808 | 3904876 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
14 | 3915676 | 3915735 | - | NZ_CP045205.1 | Citrobacter telavivensis |
15 | 3459105 | 3459164 | - | NZ_LR134475.1 | Klebsiella aerogenes |
16 | 1846057 | 1846116 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
17 | 2040067 | 2040126 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
18 | 3811464 | 3811523 | - | NZ_CP050508.1 | Raoultella terrigena |
19 | 3183114 | 3183173 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
20 | 1021791 | 1021850 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
21 | 3456754 | 3456813 | + | NZ_CP053416.1 | Salmonella bongori |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00230.22 | 0.8 | 16 | 6256 | opposite-strand | Major intrinsic protein |
2 | PF11398.10 | 1.0 | 20 | 4220 | same-strand | Protein of unknown function (DUF2813) |
3 | PF04393.15 | 0.65 | 13 | 3269.0 | opposite-strand | Protein of unknown function (DUF535) |
4 | PF16576.7 | 1.0 | 20 | 2002 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
5 | PF13437.8 | 1.0 | 20 | 2002 | same-strand | HlyD family secretion protein |
6 | PF13533.8 | 1.0 | 20 | 2002 | same-strand | Biotin-lipoyl like |
7 | PF12704.9 | 1.0 | 20 | 59 | same-strand | MacB-like periplasmic core domain |
8 | PF00005.29 | 1.0 | 20 | 59 | same-strand | ABC transporter |
9 | PF02687.23 | 1.0 | 20 | 59 | same-strand | FtsX-like permease family |
10 | PF00313.24 | 1.0 | 20 | -45 | opposite-strand | 'Cold-shock' DNA-binding domain |
11 | PF02617.19 | 1.0 | 20 | 500 | same-strand | ATP-dependent Clp protease adaptor protein ClpS |
12 | PF07724.16 | 1.0 | 20 | 850 | same-strand | AAA domain (Cdc48 subfamily) |
13 | PF17871.3 | 1.0 | 20 | 850 | same-strand | AAA lid domain |
14 | PF10431.11 | 1.0 | 20 | 850 | same-strand | C-terminal, D2-small domain, of ClpB protein |
15 | PF00004.31 | 1.0 | 20 | 850 | same-strand | ATPase family associated with various cellular activities (AAA) |
16 | PF07728.16 | 1.0 | 20 | 850 | same-strand | AAA domain (dynein-related subfamily) |
17 | PF02861.22 | 1.0 | 20 | 850 | same-strand | Clp amino terminal domain, pathogenicity island component |
18 | PF05621.13 | 1.0 | 20 | 850 | same-strand | Bacterial TniB protein |