Result : EXP00170
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00170 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2215673 |
| Right | 2215708 |
| Strand | + |
| Nucleotide Sequence | TTGGGGTCATCGCCCTGTTCCTGTTTATGGCGTTAG |
| Sequence | LGSSPCSCLWR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2944680 | 2944715 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2215673 | 2215708 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2238468 | 2238503 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1214727 | 1214762 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 1640004 | 1640039 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00528.24 | 1.0 | 4 | 37 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 2 | PF00005.29 | 1.0 | 4 | 773 | opposite-strand | ABC transporter |
| 3 | PF04069.14 | 0.75 | 3 | 2856.0 | opposite-strand | Substrate binding domain of ABC-type glycine betaine transport system |
| 4 | PF00933.23 | 0.75 | 3 | 4004.5 | opposite-strand | Glycosyl hydrolase family 3 N terminal domain |
| 5 | PF01915.24 | 0.75 | 3 | 4004.5 | opposite-strand | Glycosyl hydrolase family 3 C-terminal domain |
| 6 | PF14310.8 | 0.75 | 3 | 4004.5 | opposite-strand | Fibronectin type III-like domain |
| 7 | PF07308.15 | 0.75 | 3 | 3477 | opposite-strand | Protein of unknown function (DUF1456) |
| 8 | PF00072.26 | 0.75 | 3 | 2711 | opposite-strand | Response regulator receiver domain |
| 9 | PF04397.17 | 0.75 | 3 | 2711 | opposite-strand | LytTr DNA-binding domain |
| 10 | PF07694.14 | 0.75 | 3 | 1029 | opposite-strand | 5TMR of 5TMR-LYT |
| 11 | PF06580.15 | 0.75 | 3 | 1029 | opposite-strand | Histidine kinase |
| 12 | PF13185.8 | 0.75 | 3 | 1029 | opposite-strand | GAF domain |
| 13 | PF13492.8 | 0.75 | 3 | 1029 | opposite-strand | GAF domain |
| 14 | PF15714.7 | 0.75 | 3 | 1029 | opposite-strand | Stage V sporulation protein T C-terminal, transcription factor |
| 15 | PF13411.8 | 0.75 | 3 | 76 | same-strand | MerR HTH family regulatory protein |
| 16 | PF00376.25 | 0.75 | 3 | 76 | same-strand | MerR family regulatory protein |
++ More..