Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00165 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 1007857 |
Right | 1007892 |
Strand | + |
Nucleotide Sequence | TTGCCAGTACGGCCCGTGGGCTGGAAGAGCTGTTAA |
Sequence | LPVRPVGWKSC |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 11 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1137329 | 1137364 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 3831911 | 3831946 | - | NZ_CP045205.1 | Citrobacter telavivensis |
3 | 1834938 | 1834973 | + | NZ_CP043318.1 | Enterobacter chengduensis |
4 | 3300009 | 3300044 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
5 | 1355529 | 1355564 | - | NZ_CP016337.1 | Kosakonia sacchari |
6 | 1835510 | 1835545 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
7 | 806837 | 806872 | + | NZ_CP017279.1 | Enterobacter ludwigii |
8 | 1647287 | 1647322 | + | NZ_CP009756.1 | Enterobacter cloacae |
9 | 1708762 | 1708797 | - | NZ_CP038469.1 | Citrobacter tructae |
10 | 928641 | 928676 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
11 | 3160535 | 3160570 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
12 | 1601657 | 1601692 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
13 | 1622533 | 1622568 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
14 | 1720335 | 1720370 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
15 | 2950643 | 2950678 | - | NZ_CP045845.1 | Kluyvera intermedia |
16 | 2980669 | 2980704 | - | NZ_CP035129.1 | Kosakonia cowanii |
17 | 1019420 | 1019455 | + | NZ_AP014857.1 | Escherichia albertii |
18 | 1007857 | 1007892 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
19 | 1637797 | 1637832 | + | NZ_AP022508.1 | Enterobacter bugandensis |
20 | 994924 | 994959 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
21 | 74505 | 74540 | + | NZ_CP057657.1 | Escherichia fergusonii |
22 | 2878686 | 2878721 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
23 | 4165014 | 4165049 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
24 | 528887 | 528922 | + | NZ_CP023529.1 | Lelliottia amnigena |
25 | 1674597 | 1674632 | + | NZ_LR134340.1 | Escherichia marmotae |
26 | 2743574 | 2743609 | - | NZ_CP061527.1 | Shigella dysenteriae |
27 | 1738250 | 1738285 | + | NZ_CP015113.1 | Kosakonia radicincitans |
28 | 3452577 | 3452612 | - | NZ_CP014007.2 | Kosakonia oryzae |
29 | 2914220 | 2914255 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
30 | 1266708 | 1266743 | - | NZ_CP045300.1 | Kosakonia arachidis |
31 | 4508916 | 4508951 | + | NZ_CP033744.1 | Citrobacter freundii |
32 | 606737 | 606772 | - | NZ_CP044098.1 | Citrobacter portucalensis |
33 | 1711069 | 1711104 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
34 | 1149885 | 1149920 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
35 | 1592181 | 1592216 | + | NC_015968.1 | Enterobacter soli |
36 | 1961248 | 1961283 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
37 | 3538356 | 3538391 | + | NZ_CP053416.1 | Salmonella bongori |
38 | 1119265 | 1119300 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01180.23 | 1.0 | 37 | 1928.0 | same-strand | Dihydroorotate dehydrogenase |
2 | PF07126.14 | 1.0 | 37 | 1218.0 | same-strand | Cell-division protein ZapC |
3 | PF03473.19 | 1.0 | 37 | 112.0 | opposite-strand | MOSC domain |
4 | PF03476.18 | 1.0 | 37 | 112.0 | opposite-strand | MOSC N-terminal beta barrel domain |
5 | PF00111.29 | 1.0 | 37 | 112.0 | opposite-strand | 2Fe-2S iron-sulfur cluster binding domain |
6 | PF01170.20 | 1.0 | 37 | -35.0 | same-strand | Putative RNA methylase family UPF0020 |
7 | PF02926.19 | 1.0 | 37 | -35.0 | same-strand | THUMP domain |
8 | PF13649.8 | 0.81 | 30 | -35 | same-strand | Methyltransferase domain |
9 | PF00005.29 | 1.0 | 37 | 2073.0 | same-strand | ABC transporter |
10 | PF16326.7 | 1.0 | 37 | 2073.0 | same-strand | ABC transporter C-terminal domain |
11 | PF02463.21 | 0.86 | 32 | 2073 | same-strand | RecF/RecN/SMC N terminal domain |
12 | PF12848.9 | 1.0 | 37 | 2073.0 | same-strand | ABC transporter |
13 | PF13401.8 | 1.0 | 37 | 2073.0 | same-strand | AAA domain |
14 | PF13191.8 | 0.65 | 24 | 2073 | same-strand | AAA ATPase domain |
15 | PF04403.15 | 1.0 | 37 | 3995.0 | same-strand | Paraquat-inducible protein A |
16 | PF02470.22 | 1.0 | 37 | 5252.0 | same-strand | MlaD protein |
17 | PF03886.15 | 1.0 | 37 | 6889.5 | same-strand | ABC-type transport auxiliary lipoprotein component |
18 | PF03358.17 | 0.81 | 30 | 3187.0 | opposite-strand | NADPH-dependent FMN reductase |