Result : EXP00159
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00159 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3708114 |
| Right | 3708158 |
| Strand | + |
| Nucleotide Sequence | ATGAACGCTAAAACGCACAGCGGAAAATGCCAGGGCCAGCCATAA |
| Sequence | MNAKTHSGKCQGQP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3708114 | 3708158 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4450228 | 4450272 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 3679176 | 3679220 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3699335 | 3699379 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2453914 | 2453958 | + | NZ_CP033744.1 | Citrobacter freundii |
| 6 | 2624402 | 2624446 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 3617685 | 3617729 | - | NZ_CP038469.1 | Citrobacter tructae |
| 8 | 2605622 | 2605666 | - | NZ_CP044098.1 | Citrobacter portucalensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 7 | 4266 | opposite-strand | ABC transporter |
| 2 | PF08352.14 | 1.0 | 7 | 4266 | opposite-strand | Oligopeptide/dipeptide transporter, C-terminal region |
| 3 | PF02463.21 | 1.0 | 7 | 4122.5 | opposite-strand | RecF/RecN/SMC N terminal domain |
| 4 | PF00528.24 | 1.0 | 7 | 2759.5 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 5 | PF12911.9 | 1.0 | 7 | 3209.5 | opposite-strand | N-terminal TM domain of oligopeptide transport permease C |
| 6 | PF00496.24 | 1.0 | 7 | 409.0 | opposite-strand | Bacterial extracellular solute-binding proteins, family 5 Middle |
| 7 | PF00884.25 | 0.86 | 6 | 584 | opposite-strand | Sulfatase |
| 8 | PF03352.15 | 0.86 | 6 | 4884.5 | same-strand | Methyladenine glycosylase |
++ More..