Result : EXP00158
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00158 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3592392 |
| Right | 3592439 |
| Strand | + |
| Nucleotide Sequence | ATGCTCGAATTACAGAAAAATAACTTTTTTGTTACATTTGTAAGATAG |
| Sequence | MLELQKNNFFVTFVR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4310179 | 4310226 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3592392 | 3592439 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3562901 | 3562948 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2502003 | 2502050 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 271642 | 271689 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 3552592 | 3552642 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 4084967 | 4085014 | + | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 1359205 | 1359252 | + | NZ_CP026047.1 | Raoultella planticola |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03009.19 | 0.71 | 5 | 4279.0 | opposite-strand | Glycerophosphoryl diester phosphodiesterase family |
| 2 | PF00005.29 | 1.0 | 7 | 1515 | opposite-strand | ABC transporter |
| 3 | PF17912.3 | 0.86 | 6 | 3212 | opposite-strand | MalK OB fold domain |
| 4 | PF08402.12 | 0.86 | 6 | 3212 | opposite-strand | TOBE domain |
| 5 | PF17850.3 | 0.86 | 6 | 3212 | opposite-strand | CysA C-terminal regulatory domain |
| 6 | PF00528.24 | 1.0 | 7 | 1928.5 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 7 | PF13416.8 | 1.0 | 7 | 67.0 | opposite-strand | Bacterial extracellular solute-binding protein |
| 8 | PF01547.27 | 1.0 | 7 | 67.0 | opposite-strand | Bacterial extracellular solute-binding protein |
| 9 | PF12399.10 | 1.0 | 7 | 1417.0 | opposite-strand | Branched-chain amino acid ATP-binding cassette transporter |
| 10 | PF02653.18 | 1.0 | 7 | 2757.5 | opposite-strand | Branched-chain amino acid transport system / permease component |
| 11 | PF11862.10 | 1.0 | 7 | 2181.0 | opposite-strand | Domain of unknown function (DUF3382) |
++ More..