Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00157 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 4058279 |
Right | 4058353 |
Strand | + |
Nucleotide Sequence | ATGCTCCGTGAAAGCGATCACAAAGGGACTCTGCAATACTTGTTTGCGGAGGATGTTTGTGATCCTGTTTTGTAG |
Sequence | MLRESDHKGTLQYLFAEDVCDPVL |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4854205 | 4854279 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 4058279 | 4058353 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 4070854 | 4070928 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 4277183 | 4277257 | - | NZ_LR134340.1 | Escherichia marmotae |
5 | 4391642 | 4391716 | + | NZ_CP061527.1 | Shigella dysenteriae |
6 | 4028665 | 4028739 | + | NZ_AP014857.1 | Escherichia albertii |
7 | 3002210 | 3002284 | + | NZ_CP057657.1 | Escherichia fergusonii |
8 | 4623604 | 4623678 | - | NZ_CP045845.1 | Kluyvera intermedia |
9 | 4691421 | 4691498 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
10 | 3188711 | 3188794 | + | NZ_CP016337.1 | Kosakonia sacchari |
11 | 2910353 | 2910439 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
12 | 36659 | 36742 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
13 | 817858 | 817932 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
14 | 4614933 | 4615016 | - | NZ_CP035129.1 | Kosakonia cowanii |
15 | 4490485 | 4490568 | - | NZ_AP023184.1 | Buttiauxella agrestis |
16 | 1669208 | 1669279 | - | NZ_CP042941.1 | Atlantibacter hermannii |
17 | 3754874 | 3754945 | - | NZ_CP065534.1 | Lonsdalea populi |
18 | 1045402 | 1045473 | - | NZ_CP023009.1 | Lonsdalea britannica |
19 | 1200265 | 1200336 | - | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
20 | 2647674 | 2647745 | - | NZ_CP009781.1 | Yersinia aldovae 670-83 |
21 | 2898334 | 2898417 | + | NZ_CP009460.1 | Dickeya fangzhongdai |
22 | 4639737 | 4639820 | - | NZ_CP025799.1 | Dickeya zeae |
23 | 37640 | 37711 | + | NZ_CP043727.1 | Yersinia canariae |
24 | 41056 | 41127 | + | NZ_CP032487.1 | Yersinia hibernica |
25 | 4660776 | 4660847 | - | NZ_CP046293.1 | Yersinia intermedia |
26 | 4801246 | 4801329 | - | NZ_CP031560.1 | Dickeya dianthicola |
27 | 32533 | 32604 | + | NZ_LT615367.1 | Dickeya aquatica |
28 | 63311 | 63394 | + | NZ_CP042220.2 | Dickeya poaceiphila |
29 | 4690804 | 4690887 | - | NC_012912.1 | Dickeya chrysanthemi Ech1591 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04055.23 | 0.96 | 27 | 4682.5 | same-strand | Radical SAM superfamily |
2 | PF06969.18 | 0.93 | 26 | 4683 | same-strand | HemN C-terminal domain |
3 | PF00158.28 | 1.0 | 28 | 2919 | opposite-strand | Sigma-54 interaction domain |
4 | PF00072.26 | 1.0 | 28 | 2919 | opposite-strand | Response regulator receiver domain |
5 | PF14532.8 | 1.0 | 28 | 2919 | opposite-strand | Sigma-54 interaction domain |
6 | PF02954.21 | 1.0 | 28 | 2919 | opposite-strand | Bacterial regulatory protein, Fis family |
7 | PF07728.16 | 1.0 | 28 | 2919 | opposite-strand | AAA domain (dynein-related subfamily) |
8 | PF02518.28 | 1.0 | 28 | 1861 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
9 | PF00512.27 | 1.0 | 28 | 1861 | opposite-strand | His Kinase A (phospho-acceptor) domain |
10 | PF00120.26 | 1.0 | 28 | 245 | opposite-strand | Glutamine synthetase, catalytic domain |
11 | PF03951.21 | 1.0 | 28 | 245 | opposite-strand | Glutamine synthetase, beta-Grasp domain |
12 | PF00009.29 | 1.0 | 28 | 54 | same-strand | Elongation factor Tu GTP binding domain |
13 | PF00679.26 | 1.0 | 28 | 54 | same-strand | Elongation factor G C-terminus |
14 | PF03144.27 | 1.0 | 28 | 54 | same-strand | Elongation factor Tu domain 2 |
15 | PF01926.25 | 1.0 | 28 | 54 | same-strand | 50S ribosome-binding GTPase |
16 | PF02580.18 | 0.64 | 18 | 3476.0 | same-strand | D-Tyr-tRNA(Tyr) deacylase |
17 | PF09500.12 | 0.61 | 17 | 3938 | same-strand | Putative thioesterase (yiiD Cterm) |
18 | PF13508.9 | 0.61 | 17 | 3938 | same-strand | Acetyltransferase (GNAT) domain |