Result : EXP00157

Protein Information

• Protein name: EXP00157
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 4058279
• Right: 4058353
• Strand: +
• Nucleotide Sequence: ATGCTCCGTGAAAGCGATCACAAAGGGACTCTGCAATACTTGTTTGCGGAGGATGTTTGTGATCCTGTTTTGTAG
• Sequence: MLRESDHKGTLQYLFAEDVCDPVL
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 24

Conservation Analysis

No. of Species: 28

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4854205	4854279	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	4058279	4058353	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	4070854	4070928	+	NC_004337.2	Shigella flexneri 2a str. 301
4	4277183	4277257	-	NZ_LR134340.1	Escherichia marmotae
5	4391642	4391716	+	NZ_CP061527.1	Shigella dysenteriae
6	4028665	4028739	+	NZ_AP014857.1	Escherichia albertii
7	3002210	3002284	+	NZ_CP057657.1	Escherichia fergusonii
8	4623604	4623678	-	NZ_CP045845.1	Kluyvera intermedia
9	4691421	4691498	+	NZ_CP012871.1	[Enterobacter] lignolyticus
10	3188711	3188794	+	NZ_CP016337.1	Kosakonia sacchari
11	2910353	2910439	-	NC_009792.1	Citrobacter koseri ATCC BAA-895
12	36659	36742	+	NZ_CP063425.1	Kosakonia pseudosacchari
13	817858	817932	-	NZ_CP020388.1	Pluralibacter gergoviae
14	4614933	4615016	-	NZ_CP035129.1	Kosakonia cowanii
15	4490485	4490568	-	NZ_AP023184.1	Buttiauxella agrestis
16	1669208	1669279	-	NZ_CP042941.1	Atlantibacter hermannii
17	3754874	3754945	-	NZ_CP065534.1	Lonsdalea populi
18	1045402	1045473	-	NZ_CP023009.1	Lonsdalea britannica
19	1200265	1200336	-	NZ_CP054043.1	Yersinia mollaretii ATCC 43969
20	2647674	2647745	-	NZ_CP009781.1	Yersinia aldovae 670-83
21	2898334	2898417	+	NZ_CP009460.1	Dickeya fangzhongdai
22	4639737	4639820	-	NZ_CP025799.1	Dickeya zeae
23	37640	37711	+	NZ_CP043727.1	Yersinia canariae
24	41056	41127	+	NZ_CP032487.1	Yersinia hibernica
25	4660776	4660847	-	NZ_CP046293.1	Yersinia intermedia
26	4801246	4801329	-	NZ_CP031560.1	Dickeya dianthicola
27	32533	32604	+	NZ_LT615367.1	Dickeya aquatica
28	63311	63394	+	NZ_CP042220.2	Dickeya poaceiphila
29	4690804	4690887	-	NC_012912.1	Dickeya chrysanthemi Ech1591

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP016337.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF04055.23	0.96	27	4682.5	same-strand	Radical SAM superfamily
2	PF06969.18	0.93	26	4683	same-strand	HemN C-terminal domain
3	PF00158.28	1.0	28	2919	opposite-strand	Sigma-54 interaction domain
4	PF00072.26	1.0	28	2919	opposite-strand	Response regulator receiver domain
5	PF14532.8	1.0	28	2919	opposite-strand	Sigma-54 interaction domain
6	PF02954.21	1.0	28	2919	opposite-strand	Bacterial regulatory protein, Fis family
7	PF07728.16	1.0	28	2919	opposite-strand	AAA domain (dynein-related subfamily)
8	PF02518.28	1.0	28	1861	opposite-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
9	PF00512.27	1.0	28	1861	opposite-strand	His Kinase A (phospho-acceptor) domain
10	PF00120.26	1.0	28	245	opposite-strand	Glutamine synthetase, catalytic domain
11	PF03951.21	1.0	28	245	opposite-strand	Glutamine synthetase, beta-Grasp domain
12	PF00009.29	1.0	28	54	same-strand	Elongation factor Tu GTP binding domain
13	PF00679.26	1.0	28	54	same-strand	Elongation factor G C-terminus
14	PF03144.27	1.0	28	54	same-strand	Elongation factor Tu domain 2
15	PF01926.25	1.0	28	54	same-strand	50S ribosome-binding GTPase
16	PF02580.18	0.64	18	3476.0	same-strand	D-Tyr-tRNA(Tyr) deacylase
17	PF09500.12	0.61	17	3938	same-strand	Putative thioesterase (yiiD Cterm)
18	PF13508.9	0.61	17	3938	same-strand	Acetyltransferase (GNAT) domain