Result : EXP00156
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00156 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4075686 |
| Right | 4075760 |
| Strand | + |
| Nucleotide Sequence | ATCAGCATGAGCGTGGGGAAATTAGCGACGAAGCGTTCGCAGAGGCGCTGTGTCATGAGATGGCTCTACCGCTAA |
| Sequence | ISMSVGKLATKRSQRRCVMRWLYR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4872396 | 4872458 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4075698 | 4075760 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 4088342 | 4088404 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3010287 | 3010349 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 515 | 577 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 4046848 | 4046916 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 4263005 | 4263067 | - | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 4082276 | 4082344 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 3406026 | 3406094 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 10 | 2893894 | 2893962 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 11 | 3104572 | 3104634 | - | NZ_CP045300.1 | Kosakonia arachidis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01791.11 | 0.7 | 7 | 3064.5 | opposite-strand | DeoC/LacD family aldolase |
| 2 | PF03446.17 | 0.6 | 6 | 2127 | opposite-strand | NAD binding domain of 6-phosphogluconate dehydrogenase |
| 3 | PF14833.8 | 0.6 | 6 | 2127 | opposite-strand | NAD-binding of NADP-dependent 3-hydroxyisobutyrate dehydrogenase |
| 4 | PF00294.26 | 0.6 | 6 | 1063 | same-strand | pfkB family carbohydrate kinase |
| 5 | PF00455.24 | 0.6 | 6 | 244 | same-strand | DeoR C terminal sensor domain |
| 6 | PF08220.14 | 0.6 | 6 | 244 | same-strand | DeoR-like helix-turn-helix domain |
| 7 | PF03631.17 | 1.0 | 10 | 386 | same-strand | Virulence factor BrkB |
| 8 | PF02580.18 | 1.0 | 10 | 1255 | same-strand | D-Tyr-tRNA(Tyr) deacylase |
| 9 | PF09500.12 | 1.0 | 10 | 1737 | same-strand | Putative thioesterase (yiiD Cterm) |
| 10 | PF00583.27 | 1.0 | 10 | 1737 | same-strand | Acetyltransferase (GNAT) family |
| 11 | PF13508.9 | 1.0 | 10 | 1737 | same-strand | Acetyltransferase (GNAT) domain |
++ More..