Result : EXP00154

Protein Information

• Protein name: EXP00154
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 1147556
• Right: 1147624
• Strand: +
• Nucleotide Sequence: ATGAAGCTTAGTGAGGATTTTCCCCAGGCAACTGGGGAAAGACCAAACCGGGCGGCGACGATACCTTGA
• Sequence: MKLSEDFPQATGERPNRAATIP
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 22

Conservation Analysis

No. of Species: 18

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1506792	1506860	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	1155652	1155720	+	NZ_AP014857.1	Escherichia albertii
3	1147556	1147624	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
4	1135273	1135341	+	NC_004337.2	Shigella flexneri 2a str. 301
5	1728584	1728652	+	NZ_CP061527.1	Shigella dysenteriae
6	1790498	1790566	+	NZ_LR134340.1	Escherichia marmotae
7	879669	879737	-	NZ_CP057657.1	Escherichia fergusonii
8	2767271	2767339	-	NZ_CP045845.1	Kluyvera intermedia
9	1777534	1777605	+	NZ_AP022508.1	Enterobacter bugandensis
10	1717165	1717236	-	NZ_CP045769.1	Enterobacter cancerogenus
11	1243362	1243430	+	NC_013716.1	Citrobacter rodentium ICC168
12	958503	958574	+	NZ_CP017279.1	Enterobacter ludwigii
13	2012945	2013016	+	NZ_CP043318.1	Enterobacter chengduensis
14	1789909	1789980	+	NZ_CP009756.1	Enterobacter cloacae
15	763781	763852	-	NZ_CP025034.2	Enterobacter sp. SGAir0187
16	1743124	1743195	+	NZ_CP017184.1	Enterobacter roggenkampii
17	1809154	1809225	+	NZ_CP027986.1	Enterobacter sichuanensis
18	4266040	4266111	+	NZ_AP019007.1	Enterobacter oligotrophicus
19	3441377	3441445	+	NZ_LT556085.1	Citrobacter amalonaticus

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF10150.11	0.89	16	3078	opposite-strand	Ribonuclease E/G family
2	PF12111.10	0.89	16	3078	opposite-strand	Polyribonucleotide phosphorylase C terminal
3	PF00575.25	0.89	16	3078	opposite-strand	S1 RNA binding domain
4	PF00849.24	0.94	17	1566.5	same-strand	RNA pseudouridylate synthase
5	PF01479.27	0.94	17	1566.5	same-strand	S4 domain
6	PF02545.16	0.94	17	908.0	opposite-strand	Maf-like protein
7	PF02620.19	1.0	18	206	same-strand	Large ribosomal RNA subunit accumulation protein YceD
8	PF01783.25	1.0	18	16	same-strand	Ribosomal L32p protein family
9	PF02504.17	0.89	16	27	same-strand	Fatty acid synthesis protein
10	PF08541.12	1.0	18	1111	same-strand	3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal
11	PF08545.12	1.0	18	1111	same-strand	3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III
12	PF01154.19	0.94	17	1086.5	same-strand	Hydroxymethylglutaryl-coenzyme A synthase N terminal
13	PF00698.23	1.0	18	2082	same-strand	Acyl transferase domain
14	PF13561.8	1.0	18	3023	same-strand	Enoyl-(Acyl carrier protein) reductase
15	PF00106.27	1.0	18	3023	same-strand	short chain dehydrogenase
16	PF08659.12	1.0	18	3023	same-strand	KR domain
17	PF13460.8	1.0	18	3023	same-strand	NAD(P)H-binding
18	PF00550.27	1.0	18	3838	same-strand	Phosphopantetheine attachment site