| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00154 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1147556 |
| Right | 1147624 |
| Strand | + |
| Nucleotide Sequence | ATGAAGCTTAGTGAGGATTTTCCCCAGGCAACTGGGGAAAGACCAAACCGGGCGGCGACGATACCTTGA |
| Sequence | MKLSEDFPQATGERPNRAATIP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1506792 | 1506860 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1155652 | 1155720 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 1147556 | 1147624 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1135273 | 1135341 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 1728584 | 1728652 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 1790498 | 1790566 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 879669 | 879737 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 8 | 2767271 | 2767339 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 9 | 1777534 | 1777605 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 10 | 1717165 | 1717236 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 11 | 1243362 | 1243430 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 12 | 958503 | 958574 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 13 | 2012945 | 2013016 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 14 | 1789909 | 1789980 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 15 | 763781 | 763852 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 16 | 1743124 | 1743195 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 17 | 1809154 | 1809225 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 18 | 4266040 | 4266111 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 19 | 3441377 | 3441445 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10150.11 | 0.89 | 16 | 3078 | opposite-strand | Ribonuclease E/G family |
| 2 | PF12111.10 | 0.89 | 16 | 3078 | opposite-strand | Polyribonucleotide phosphorylase C terminal |
| 3 | PF00575.25 | 0.89 | 16 | 3078 | opposite-strand | S1 RNA binding domain |
| 4 | PF00849.24 | 0.94 | 17 | 1566.5 | same-strand | RNA pseudouridylate synthase |
| 5 | PF01479.27 | 0.94 | 17 | 1566.5 | same-strand | S4 domain |
| 6 | PF02545.16 | 0.94 | 17 | 908.0 | opposite-strand | Maf-like protein |
| 7 | PF02620.19 | 1.0 | 18 | 206 | same-strand | Large ribosomal RNA subunit accumulation protein YceD |
| 8 | PF01783.25 | 1.0 | 18 | 16 | same-strand | Ribosomal L32p protein family |
| 9 | PF02504.17 | 0.89 | 16 | 27 | same-strand | Fatty acid synthesis protein |
| 10 | PF08541.12 | 1.0 | 18 | 1111 | same-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal |
| 11 | PF08545.12 | 1.0 | 18 | 1111 | same-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III |
| 12 | PF01154.19 | 0.94 | 17 | 1086.5 | same-strand | Hydroxymethylglutaryl-coenzyme A synthase N terminal |
| 13 | PF00698.23 | 1.0 | 18 | 2082 | same-strand | Acyl transferase domain |
| 14 | PF13561.8 | 1.0 | 18 | 3023 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 15 | PF00106.27 | 1.0 | 18 | 3023 | same-strand | short chain dehydrogenase |
| 16 | PF08659.12 | 1.0 | 18 | 3023 | same-strand | KR domain |
| 17 | PF13460.8 | 1.0 | 18 | 3023 | same-strand | NAD(P)H-binding |
| 18 | PF00550.27 | 1.0 | 18 | 3838 | same-strand | Phosphopantetheine attachment site |