Result : EXP00153
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00153 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4406467 |
| Right | 4406502 |
| Strand | + |
| Nucleotide Sequence | GTGAGTTTTGCCACATTACACCTGCCTGTAGGTTGA |
| Sequence | VSFATLHLPVG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5260320 | 5260355 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4406467 | 4406502 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 4511285 | 4511320 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3326948 | 3326983 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 3858030 | 3858065 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01145.27 | 1.0 | 4 | 2666.5 | same-strand | SPFH domain / Band 7 family |
| 2 | PF12221.10 | 1.0 | 4 | 3170 | same-strand | Bacterial membrane protein N terminal |
| 3 | PF09838.11 | 1.0 | 4 | 1884 | same-strand | Uncharacterized protein conserved in bacteria (DUF2065) |
| 4 | PF00709.23 | 1.0 | 4 | 482 | same-strand | Adenylosuccinate synthetase |
| 5 | PF02082.22 | 1.0 | 4 | -35 | same-strand | Iron-dependent Transcriptional regulator |
| 6 | PF00773.21 | 1.0 | 4 | 152 | same-strand | RNB domain |
| 7 | PF08206.13 | 1.0 | 4 | 152 | same-strand | Ribonuclease B OB domain |
| 8 | PF17876.3 | 1.0 | 4 | 152 | same-strand | Cold shock domain |
| 9 | PF00575.25 | 1.0 | 4 | 152 | same-strand | S1 RNA binding domain |
| 10 | PF08461.12 | 1.0 | 4 | 152 | same-strand | Ribonuclease R winged-helix domain |
| 11 | PF00588.21 | 1.0 | 4 | 2773 | same-strand | SpoU rRNA Methylase family |
| 12 | PF08032.14 | 1.0 | 4 | 2773 | same-strand | RNA 2'-O ribose methyltransferase substrate binding |
++ More..