Result : EXP00152
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00152 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1289345 |
| Right | 1289431 |
| Strand | + |
| Nucleotide Sequence | TTGATATCGTTGCAGGATGTTCAATTGGTTCGCTGGTGGGCGCTGCCTATGCATGCGATCGATTATCTGCGCTGGAAGATTGGGTGA |
| Sequence | LISLQDVQLVRWWALPMHAIDYLRWKIG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1289345 | 1289431 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1734527 | 1734613 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1284384 | 1284470 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2413167 | 2413253 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1297875 | 1297961 | + | NZ_AP014857.1 | Escherichia albertii |
| 6 | 3942473 | 3942559 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02665.16 | 0.8 | 4 | 2641 | same-strand | Nitrate reductase gamma subunit |
| 2 | PF00551.21 | 1.0 | 5 | 721.0 | opposite-strand | Formyl transferase |
| 3 | PF01842.27 | 1.0 | 5 | 721.0 | opposite-strand | ACT domain |
| 4 | PF17775.3 | 1.0 | 5 | 213.0 | opposite-strand | UPF0225 domain |
| 5 | PF02810.17 | 1.0 | 5 | 213.0 | opposite-strand | SEC-C motif |
| 6 | PF01734.24 | 1.0 | 5 | -86.0 | same-strand | Patatin-like phospholipase |
| 7 | PF00072.26 | 1.0 | 5 | 811.0 | same-strand | Response regulator receiver domain |
| 8 | PF00483.25 | 1.0 | 5 | 2026.0 | same-strand | Nucleotidyl transferase |
| 9 | PF00816.23 | 1.0 | 5 | 3078.0 | opposite-strand | H-NS histone family |
| 10 | PF00265.20 | 0.6 | 3 | 4096.0 | same-strand | Thymidine kinase |
++ More..