Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00150 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 4093059 |
Right | 4093136 |
Strand | + |
Nucleotide Sequence | ATGTTTAATTTTTCAAATCGAAATTTAAAATATTGTGCCGGAGGCATCTCTGGCACATTGGGCAATTACGGCAGGTAA |
Sequence | MFNFSNRNLKYCAGGISGTLGNYGR |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 25 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4093059 | 4093136 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 4106915 | 4106992 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF08279.14 | 1.0 | 2 | 3204.0 | opposite-strand | HTH domain |
2 | PF05343.16 | 1.0 | 2 | 2134.0 | opposite-strand | M42 glutamyl aminopeptidase |
3 | PF02378.20 | 1.0 | 2 | 693.0 | opposite-strand | Phosphotransferase system, EIIC |
4 | PF02302.19 | 1.0 | 2 | 693.0 | opposite-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
5 | PF00359.24 | 1.0 | 2 | 236.0 | opposite-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
6 | PF05336.15 | 1.0 | 2 | -12.0 | opposite-strand | L-rhamnose mutarotase |
7 | PF00596.23 | 1.0 | 2 | 312.0 | opposite-strand | Class II Aldolase and Adducin N-terminal domain |
8 | PF06134.13 | 1.0 | 2 | 1482.5 | opposite-strand | L-rhamnose isomerase (RhaA) |
9 | PF00370.23 | 1.0 | 2 | 2738.5 | opposite-strand | FGGY family of carbohydrate kinases, N-terminal domain |
10 | PF02782.18 | 1.0 | 2 | 2738.5 | opposite-strand | FGGY family of carbohydrate kinases, C-terminal domain |
11 | PF12833.9 | 1.0 | 2 | 4495.5 | same-strand | Helix-turn-helix domain |
12 | PF02311.21 | 1.0 | 2 | 4495.5 | same-strand | AraC-like ligand binding domain |
13 | PF00165.25 | 1.0 | 2 | 4495.5 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |