Result : EXP00148
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00148 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1028262 |
| Right | 1028300 |
| Strand | + |
| Nucleotide Sequence | ATGAGCAAGCGGCAGTACTGGCACGGGATGCCGGGTTAA |
| Sequence | MSKRQYWHGMPG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1157734 | 1157772 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1028262 | 1028300 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1016185 | 1016223 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2721881 | 2721919 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03733.15 | 1.0 | 3 | 3914.0 | opposite-strand | Inner membrane component domain |
| 2 | PF12462.10 | 1.0 | 3 | 1737.0 | same-strand | DNA helicase IV / RNA helicase N terminal |
| 3 | PF00580.23 | 1.0 | 3 | 1737.0 | same-strand | UvrD/REP helicase N-terminal domain |
| 4 | PF13245.8 | 1.0 | 3 | 1737.0 | same-strand | AAA domain |
| 5 | PF02142.24 | 1.0 | 3 | 1247.0 | opposite-strand | MGS-like domain |
| 6 | PF09829.11 | 1.0 | 3 | 489.0 | opposite-strand | Uncharacterized protein conserved in bacteria (DUF2057) |
| 7 | PF13380.8 | 1.0 | 3 | -38.0 | same-strand | CoA binding domain |
| 8 | PF02629.21 | 1.0 | 3 | -38.0 | same-strand | CoA binding domain |
| 9 | PF08755.13 | 1.0 | 3 | 104.0 | opposite-strand | Hemimethylated DNA-binding protein YccV like |
| 10 | PF10672.11 | 1.0 | 3 | 479 | opposite-strand | S-adenosylmethionine-dependent methyltransferase |
| 11 | PF17785.3 | 1.0 | 3 | 479.0 | opposite-strand | PUA-like domain |
| 12 | PF00708.20 | 1.0 | 3 | 1764.0 | same-strand | Acylphosphatase |
| 13 | PF04358.15 | 1.0 | 3 | 2039.0 | opposite-strand | DsrC like protein |
| 14 | PF01027.22 | 0.67 | 2 | 2459 | opposite-strand | Inhibitor of apoptosis-promoting Bax1 |
++ More..