Result : EXP00146
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00146 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2284154 |
| Right | 2284231 |
| Strand | + |
| Nucleotide Sequence | ATGAACAGGTTGAACAATTGCTCGCAGAGCTGCTCAACGTACTGGAAAAACATAAGGCTCCGACCGACCTTTCCCTGA |
| Sequence | MNRLNNCSQSCSTYWKNIRLRPTFP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 39
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3019219 | 3019296 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2284154 | 2284231 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2307357 | 2307434 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2830842 | 2830919 | + | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 2774236 | 2774313 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 2293285 | 2293362 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 1527052 | 1527129 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 8 | 3167178 | 3167255 | + | NC_015968.1 | Enterobacter soli |
| 9 | 2437799 | 2437867 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 10 | 2329240 | 2329308 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 11 | 4523776 | 4523844 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 12 | 3313154 | 3313231 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 13 | 3206215 | 3206292 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 14 | 2457509 | 2457586 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 15 | 4080408 | 4080485 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 16 | 3158100 | 3158177 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 17 | 3174733 | 3174810 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 18 | 3571075 | 3571143 | + | NZ_LT906479.1 | Serratia ficaria |
| 19 | 1282317 | 1282394 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 20 | 310042 | 310119 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 21 | 4776552 | 4776629 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 22 | 944561 | 944629 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 23 | 1585966 | 1586043 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 24 | 1751245 | 1751322 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 25 | 3521211 | 3521279 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 26 | 2828306 | 2828374 | + | NZ_CP016948.1 | Serratia surfactantfaciens |
| 27 | 1555353 | 1555421 | - | NZ_CP071320.1 | Serratia ureilytica |
| 28 | 851748 | 851816 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 29 | 2885199 | 2885267 | - | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 30 | 4797235 | 4797303 | + | NZ_CP065640.1 | Serratia rubidaea |
| 31 | 3441567 | 3441635 | + | NZ_CP023009.1 | Lonsdalea britannica |
| 32 | 3625768 | 3625836 | + | NC_015567.1 | Serratia plymuthica AS9 |
| 33 | 5661500 | 5661568 | + | NZ_CP011254.1 | Serratia fonticola |
| 34 | 1168639 | 1168707 | - | NZ_CP032487.1 | Yersinia hibernica |
| 35 | 3426837 | 3426914 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 36 | 1999846 | 1999914 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 37 | 3613519 | 3613587 | + | NZ_LR134494.1 | Serratia quinivorans |
| 38 | 1965283 | 1965360 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 39 | 4285857 | 4285937 | + | NZ_AP017900.1 | Nocardia seriolae |
| 40 | 1655498 | 1655566 | - | NZ_CP011118.1 | Yersinia enterocolitica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00849.24 | 0.79 | 31 | 3670.5 | opposite-strand | RNA pseudouridylate synthase |
| 2 | PF01479.27 | 0.79 | 31 | 3670.5 | opposite-strand | S4 domain |
| 3 | PF04851.17 | 0.87 | 34 | 1754 | same-strand | Type III restriction enzyme, res subunit |
| 4 | PF00271.33 | 0.87 | 34 | 1754 | same-strand | Helicase conserved C-terminal domain |
| 5 | PF00270.31 | 0.87 | 34 | 1754 | same-strand | DEAD/DEAH box helicase |
| 6 | PF01386.21 | 0.92 | 36 | 1308 | same-strand | Ribosomal L25p family |
| 7 | PF04245.15 | 0.97 | 38 | 207 | opposite-strand | 37-kD nucleoid-associated bacterial protein |
| 8 | PF07208.13 | 0.97 | 38 | -77 | same-strand | Protein of unknown function (DUF1414) |
| 9 | PF11893.10 | 0.97 | 38 | 145 | same-strand | Domain of unknown function (DUF3413) |
| 10 | PF00884.25 | 0.97 | 38 | 145 | same-strand | Sulfatase |
++ More..