Result : EXP00143
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00143 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1272449 |
| Right | 1272505 |
| Strand | + |
| Nucleotide Sequence | ATGTCCGGAAGACACCAAAAAGTTGTCGCAGGGAAGTATGCAGTGGCGGAAGTGTAA |
| Sequence | MSGRHQKVVAGKYAVAEV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1272449 | 1272505 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1268261 | 1268317 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 1717928 | 1717984 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2899173 | 2899229 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 5 | 4057609 | 4057665 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 2430080 | 2430136 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 1249969 | 1250025 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01699.26 | 1.0 | 6 | 613 | opposite-strand | Sodium/calcium exchanger protein |
| 2 | PF06150.14 | 1.0 | 6 | 100 | same-strand | ChaB |
| 3 | PF04752.14 | 1.0 | 6 | -19 | same-strand | ChaC-like protein |
| 4 | PF02635.17 | 1.0 | 6 | 744 | opposite-strand | DsrE/DsrF-like family |
| 5 | PF11924.10 | 0.67 | 4 | 1279 | same-strand | Inverse autotransporter, beta-domain |
| 6 | PF00072.26 | 0.67 | 4 | 2678 | opposite-strand | Response regulator receiver domain |
| 7 | PF00196.21 | 0.67 | 4 | 2678 | opposite-strand | Bacterial regulatory proteins, luxR family |
| 8 | PF08281.14 | 0.67 | 4 | 2678 | opposite-strand | Sigma-70, region 4 |
| 9 | PF04545.18 | 0.67 | 4 | 2678 | opposite-strand | Sigma-70, region 4 |
| 10 | PF13936.8 | 0.67 | 4 | 2678 | opposite-strand | Helix-turn-helix domain |
| 11 | PF13412.8 | 0.67 | 4 | 2678 | opposite-strand | Winged helix-turn-helix DNA-binding |
| 12 | PF13369.8 | 0.67 | 4 | 2698.5 | same-strand | Transglutaminase-like superfamily |
| 13 | PF13371.8 | 0.67 | 4 | 2698.5 | same-strand | Tetratricopeptide repeat |
| 14 | PF00793.22 | 1.0 | 6 | 2090.0 | same-strand | DAHP synthetase I family |
++ More..