Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00142 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 1936522 |
Right | 1936563 |
Strand | + |
Nucleotide Sequence | ATGAAAAAAAATAACAACTTTTTTATCTGCTTTTGTCATTAA |
Sequence | MKKNNNFFICFCH |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 13 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2538490 | 2538531 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 1936522 | 1936563 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 1900395 | 1900436 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 1913561 | 1913602 | - | NZ_LR134340.1 | Escherichia marmotae |
5 | 2508171 | 2508212 | + | NZ_CP061527.1 | Shigella dysenteriae |
6 | 1876472 | 1876513 | + | NZ_AP014857.1 | Escherichia albertii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF02222.24 | 1.0 | 5 | 4463.0 | same-strand | ATP-grasp domain |
2 | PF02655.16 | 1.0 | 5 | 4463.0 | same-strand | ATP-grasp domain |
3 | PF01081.21 | 1.0 | 5 | 3766.0 | opposite-strand | KDPG and KHG aldolase |
4 | PF00920.23 | 1.0 | 5 | 1918.0 | opposite-strand | Dehydratase family |
5 | PF02781.18 | 1.0 | 5 | 208.0 | opposite-strand | Glucose-6-phosphate dehydrogenase, C-terminal domain |
6 | PF00479.24 | 1.0 | 5 | 208.0 | opposite-strand | Glucose-6-phosphate dehydrogenase, NAD binding domain |
7 | PF01418.19 | 1.0 | 5 | 89.0 | same-strand | Helix-turn-helix domain, rpiR family |
8 | PF01380.24 | 1.0 | 5 | 89.0 | same-strand | SIS domain |
9 | PF00224.23 | 1.0 | 5 | 1085.5 | same-strand | Pyruvate kinase, barrel domain |
10 | PF02887.18 | 1.0 | 5 | 1085.5 | same-strand | Pyruvate kinase, alpha/beta domain |
11 | PF03279.15 | 1.0 | 5 | 2659.0 | opposite-strand | Bacterial lipid A biosynthesis acyltransferase |
12 | PF19425.1 | 1.0 | 5 | 3750.0 | opposite-strand | Csd3 second domain |
13 | PF01551.24 | 1.0 | 5 | 3750.0 | opposite-strand | Peptidase family M23 |
14 | PF04225.14 | 1.0 | 5 | 3750.0 | opposite-strand | Opacity-associated protein A LysM-like domain |
15 | PF08525.13 | 1.0 | 5 | 3750.0 | opposite-strand | Opacity-associated protein A N-terminal motif |
16 | PF01476.22 | 1.0 | 5 | 3750.0 | opposite-strand | LysM domain |
17 | PF01297.19 | 0.8 | 4 | 5088 | opposite-strand | Zinc-uptake complex component A periplasmic |