Result : EXP00142
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00142 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1936522 |
| Right | 1936563 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAAAAATAACAACTTTTTTATCTGCTTTTGTCATTAA |
| Sequence | MKKNNNFFICFCH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2538490 | 2538531 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1936522 | 1936563 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1900395 | 1900436 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1913561 | 1913602 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 2508171 | 2508212 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 1876472 | 1876513 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02222.24 | 1.0 | 5 | 4463.0 | same-strand | ATP-grasp domain |
| 2 | PF02655.16 | 1.0 | 5 | 4463.0 | same-strand | ATP-grasp domain |
| 3 | PF01081.21 | 1.0 | 5 | 3766.0 | opposite-strand | KDPG and KHG aldolase |
| 4 | PF00920.23 | 1.0 | 5 | 1918.0 | opposite-strand | Dehydratase family |
| 5 | PF02781.18 | 1.0 | 5 | 208.0 | opposite-strand | Glucose-6-phosphate dehydrogenase, C-terminal domain |
| 6 | PF00479.24 | 1.0 | 5 | 208.0 | opposite-strand | Glucose-6-phosphate dehydrogenase, NAD binding domain |
| 7 | PF01418.19 | 1.0 | 5 | 89.0 | same-strand | Helix-turn-helix domain, rpiR family |
| 8 | PF01380.24 | 1.0 | 5 | 89.0 | same-strand | SIS domain |
| 9 | PF00224.23 | 1.0 | 5 | 1085.5 | same-strand | Pyruvate kinase, barrel domain |
| 10 | PF02887.18 | 1.0 | 5 | 1085.5 | same-strand | Pyruvate kinase, alpha/beta domain |
| 11 | PF03279.15 | 1.0 | 5 | 2659.0 | opposite-strand | Bacterial lipid A biosynthesis acyltransferase |
| 12 | PF19425.1 | 1.0 | 5 | 3750.0 | opposite-strand | Csd3 second domain |
| 13 | PF01551.24 | 1.0 | 5 | 3750.0 | opposite-strand | Peptidase family M23 |
| 14 | PF04225.14 | 1.0 | 5 | 3750.0 | opposite-strand | Opacity-associated protein A LysM-like domain |
| 15 | PF08525.13 | 1.0 | 5 | 3750.0 | opposite-strand | Opacity-associated protein A N-terminal motif |
| 16 | PF01476.22 | 1.0 | 5 | 3750.0 | opposite-strand | LysM domain |
| 17 | PF01297.19 | 0.8 | 4 | 5088 | opposite-strand | Zinc-uptake complex component A periplasmic |
++ More..