Result : EXP00137
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00137 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1442922 |
| Right | 1442981 |
| Strand | + |
| Nucleotide Sequence | ATGGCGATATTGAAAAATTCATCAACAACTATGCTTAGTGTAGGCGCAACCTTCAACTGA |
| Sequence | MAILKNSSTTMLSVGATFN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1980561 | 1980620 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1442922 | 1442981 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1852306 | 1852365 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2258279 | 2258338 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2286888 | 2286947 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01855.21 | 0.75 | 3 | 2138.0 | opposite-strand | Pyruvate flavodoxin/ferredoxin oxidoreductase, thiamine diP-bdg |
| 2 | PF01558.20 | 0.75 | 3 | 2138.0 | opposite-strand | Pyruvate ferredoxin/flavodoxin oxidoreductase |
| 3 | PF10371.11 | 0.75 | 3 | 2138.0 | opposite-strand | Domain of unknown function |
| 4 | PF13484.8 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S double cluster binding domain |
| 5 | PF12838.9 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S dicluster domain |
| 6 | PF00037.29 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S binding domain |
| 7 | PF13187.8 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S dicluster domain |
| 8 | PF14697.8 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S dicluster domain |
| 9 | PF12837.9 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S binding domain |
| 10 | PF13237.8 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S dicluster domain |
| 11 | PF13534.8 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S dicluster domain |
| 12 | PF13183.8 | 0.75 | 3 | 2138.0 | opposite-strand | 4Fe-4S dicluster domain |
| 13 | PF03891.17 | 0.75 | 3 | 1598.0 | same-strand | Domain of unknown function (DUF333) |
| 14 | PF03724.18 | 0.75 | 3 | 1202.5 | opposite-strand | META domain |
| 15 | PF02826.21 | 1.0 | 4 | 79 | opposite-strand | D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain |
| 16 | PF00389.32 | 1.0 | 4 | 79 | opposite-strand | D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain |
| 17 | PF11739.10 | 1.0 | 4 | 70 | same-strand | Dicarboxylate transport |
| 18 | PF13617.8 | 1.0 | 4 | 2706 | same-strand | YnbE-like lipoprotein |
| 19 | PF07027.14 | 0.75 | 3 | 2899.0 | same-strand | Protein of unknown function (DUF1318) |
++ More..