Result : EXP00133
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00133 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2592274 |
| Right | 2592393 |
| Strand | + |
| Nucleotide Sequence | ATGAATTCTTCCCGGCGACCAGTATGCAGATTGCCAATATTCAGGCGGGAACGGGCAGTAACAACGTTATTCCGGGTGAACTGTTTGTGCAGTTTAACTTCCGCTTCAGCACCGAACTGA |
| Sequence | MNSSRRPVCRLPIFRRERAVTTLFRVNCLCSLTSASAPN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 39 |
++ More..
| Conservation Analysis |
No. of Species: 29
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3308533 | 3308652 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2592274 | 2592393 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2580331 | 2580450 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1156470 | 1156589 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4247734 | 4247853 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 2559254 | 2559373 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 1473324 | 1473443 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 8 | 3386509 | 3386628 | + | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 9 | 2490678 | 2490803 | + | NZ_CP028271.1 | Mixta intestinalis |
| 10 | 4771632 | 4771751 | - | NZ_CP038469.1 | Citrobacter tructae |
| 11 | 308184 | 308303 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 2290250 | 2290375 | + | NZ_CP067057.1 | Rahnella aceris |
| 13 | 2149460 | 2149579 | - | NZ_CP030753.1 | Actinobacillus pleuropneumoniae |
| 14 | 3690590 | 3690727 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 15 | 2547348 | 2547467 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 16 | 685937 | 686056 | - | NZ_CP016176.1 | Xenorhabdus hominickii |
| 17 | 3115696 | 3115815 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 18 | 2797202 | 2797321 | + | NZ_CP014137.1 | Brenneria goodwinii |
| 19 | 3306725 | 3306844 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 20 | 1382394 | 1382513 | - | NZ_LR134373.1 | Yersinia pseudotuberculosis |
| 21 | 4883050 | 4883169 | + | NZ_CP007230.1 | Yersinia similis |
| 22 | 2570931 | 2571050 | + | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
| 23 | 1278630 | 1278749 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 24 | 4812841 | 4812960 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 25 | 1778479 | 1778598 | - | NZ_CP009159.1 | Actinobacillus suis ATCC 33415 |
| 26 | 1910589 | 1910708 | - | NZ_CP072455.1 | Xenorhabdus budapestensis |
| 27 | 2549049 | 2549168 | + | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 28 | 1591585 | 1591713 | - | NZ_CP050851.1 | Aeromonas hydrophila |
| 29 | 1116237 | 1116356 | - | NZ_CP034035.1 | Brenneria rubrifaciens |
| 30 | 1196101 | 1196220 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03960.17 | 1.0 | 29 | 671.0 | same-strand | ArsC family |
| 2 | PF01546.30 | 1.0 | 29 | -119 | same-strand | Peptidase family M20/M25/M40 |
| 3 | PF07687.16 | 1.0 | 29 | -119 | same-strand | Peptidase dimerisation domain |
| 4 | PF13980.8 | 0.9 | 26 | 369 | same-strand | Uncharacterised protein family (UPF0370) |
| 5 | PF05127.16 | 0.72 | 21 | 1406.5 | opposite-strand | Helicase |
| 6 | PF17176.6 | 0.76 | 22 | 1391 | opposite-strand | tRNA-binding domain |
| 7 | PF08351.13 | 0.72 | 21 | 1406.5 | opposite-strand | Domain of unknown function (DUF1726) |
++ More..