Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00132 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 715310 |
Right | 715396 |
Strand | + |
Nucleotide Sequence | TTGAATTTAAGCGATTTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCAAAAACAACGAACACTTTGTCAACAAACTGAGTAG |
Sequence | LNLSDFVGRIRRSRRIRQKQRTLCQQTE |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 28 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 715310 | 715396 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 431014 | 431088 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 1081094 | 1081195 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
4 | 3741010 | 3741090 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
5 | 4079985 | 4080071 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
6 | 3330434 | 3330511 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
7 | 3301510 | 3301584 | + | NZ_CP061527.1 | Shigella dysenteriae |
8 | 4153 | 4239 | - | NZ_CP061527.1 | Shigella dysenteriae |
9 | 360512 | 360586 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
10 | 3722584 | 3722664 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
11 | 4095394 | 4095480 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
12 | 3995471 | 3995554 | + | NZ_LR134340.1 | Escherichia marmotae |
13 | 4236143 | 4236229 | + | NZ_LR134340.1 | Escherichia marmotae |
14 | 1134816 | 1134893 | - | NZ_LR134340.1 | Escherichia marmotae |
15 | 370865 | 370939 | + | NZ_LR134340.1 | Escherichia marmotae |
16 | 751507 | 751602 | - | NZ_LR134340.1 | Escherichia marmotae |
17 | 2839241 | 2839318 | - | NZ_AP014857.1 | Escherichia albertii |
18 | 3314006 | 3314083 | - | NZ_AP014857.1 | Escherichia albertii |
19 | 4300633 | 4300710 | + | NZ_AP014857.1 | Escherichia albertii |
20 | 2271978 | 2272058 | - | NZ_AP014857.1 | Escherichia albertii |
21 | 2802837 | 2802914 | - | NZ_AP014857.1 | Escherichia albertii |
22 | 495270 | 495344 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
23 | 4487223 | 4487297 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
24 | 4878748 | 4878834 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01702.20 | 0.6 | 3 | 3750 | same-strand | Queuine tRNA-ribosyltransferase |
2 | PF02699.17 | 0.6 | 3 | 3395 | same-strand | Preprotein translocase subunit |
3 | PF13721.8 | 0.6 | 3 | 1520.0 | same-strand | SecD export protein N-terminal TM region |
4 | PF02355.18 | 0.6 | 3 | 1342.0 | same-strand | Protein export membrane protein |
5 | PF07549.16 | 0.6 | 3 | 538.0 | same-strand | SecD/SecF GG Motif |
6 | PF01844.25 | 0.6 | 3 | 62.0 | same-strand | HNH endonuclease |
7 | PF03502.15 | 0.6 | 3 | 41.0 | opposite-strand | Nucleoside-specific channel-forming protein, Tsx |
8 | PF11622.10 | 0.6 | 3 | 1224.0 | opposite-strand | Protein of unknown function (DUF3251) |
9 | PF03477.18 | 0.6 | 3 | 1914.0 | same-strand | ATP cone domain |
10 | PF01872.19 | 0.6 | 3 | 2367.0 | same-strand | RibD C-terminal domain |
11 | PF00383.25 | 0.6 | 3 | 2367.0 | same-strand | Cytidine and deoxycytidylate deaminase zinc-binding region |
12 | PF14437.8 | 0.6 | 3 | 2367.0 | same-strand | MafB19-like deaminase |
13 | PF00885.21 | 0.6 | 3 | 3559.0 | same-strand | 6,7-dimethyl-8-ribityllumazine synthase |
14 | PF00165.25 | 0.8 | 4 | 4853 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
15 | PF12833.9 | 0.8 | 4 | 4812.0 | both-strands | Helix-turn-helix domain |
16 | PF01832.22 | 0.6 | 3 | 3836.0 | opposite-strand | Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase |
17 | PF00037.29 | 0.6 | 3 | 19.5 | opposite-strand | 4Fe-4S binding domain |
18 | PF13247.8 | 0.8 | 4 | 904.0 | both-strands | 4Fe-4S dicluster domain |
19 | PF12837.9 | 0.8 | 4 | 904.0 | both-strands | 4Fe-4S binding domain |
20 | PF13187.8 | 0.8 | 4 | 904.0 | both-strands | 4Fe-4S dicluster domain |
21 | PF12838.9 | 0.8 | 4 | 904.0 | both-strands | 4Fe-4S dicluster domain |
22 | PF12797.9 | 0.6 | 3 | 19.5 | opposite-strand | 4Fe-4S binding domain |
23 | PF13237.8 | 0.8 | 4 | 904.0 | both-strands | 4Fe-4S dicluster domain |
24 | PF12800.9 | 0.6 | 3 | 19.5 | opposite-strand | 4Fe-4S binding domain |
25 | PF01614.20 | 0.6 | 3 | 594 | opposite-strand | Bacterial transcriptional regulator |
26 | PF09339.12 | 0.6 | 3 | 594 | opposite-strand | IclR helix-turn-helix domain |
27 | PF02615.16 | 0.6 | 3 | 1643 | same-strand | Malate/L-lactate dehydrogenase |
28 | PF04216.14 | 0.6 | 3 | 228.0 | same-strand | Protein involved in formate dehydrogenase formation |
29 | PF01292.22 | 0.6 | 3 | 1154.0 | same-strand | Prokaryotic cytochrome b561 |
30 | PF09163.13 | 0.6 | 3 | 1786.0 | same-strand | Formate dehydrogenase N, transmembrane |
31 | PF14697.8 | 0.8 | 4 | 1786 | same-strand | 4Fe-4S dicluster domain |
32 | PF01568.23 | 0.6 | 3 | 2701.0 | same-strand | Molydopterin dinucleotide binding domain |
33 | PF04879.18 | 0.6 | 3 | 5164.0 | same-strand | Molybdopterin oxidoreductase Fe4S4 domain |
34 | PF00004.31 | 0.6 | 3 | 3495.0 | both-strands | ATPase family associated with various cellular activities (AAA) |