Result : EXP00130

Protein Information

• Protein name: EXP00130
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 4132397
• Right: 4132483
• Strand: +
• Nucleotide Sequence: ATGGTTAGTTTATATTTGCAGTCCGGTTTGCTTTGCATACCGGATTTTCTTTTTCTTACCATCCTGAAGTTTTTTCATCTTCCCTGA
• Sequence: MVSLYLQSGLLCIPDFLFLTILKFFHLP
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 28

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4939406	4939492	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	4132397	4132483	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	4147474	4147560	+	NC_004337.2	Shigella flexneri 2a str. 301

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF05708.14	1.0	2	4503	opposite-strand	Permuted papain-like amidase enzyme, YaeF/YiiX, C92 family
2	PF01340.22	1.0	2	4002	opposite-strand	Met Apo-repressor, MetJ
3	PF01053.22	1.0	2	2565	same-strand	Cys/Met metabolism PLP-dependent enzyme
4	PF00742.21	1.0	2	130	same-strand	Homoserine dehydrogenase
5	PF00696.30	1.0	2	130	same-strand	Amino acid kinase family
6	PF03447.18	1.0	2	130	same-strand	Homoserine dehydrogenase, NAD binding domain
7	PF02219.19	1.0	2	133	same-strand	Methylenetetrahydrofolate reductase
8	PF00141.25	1.0	2	1352	same-strand	Peroxidase
9	PF00892.22	1.0	2	3626	same-strand	EamA-like transporter family
10	PF01197.20	1.0	2	5172.0	same-strand	Ribosomal protein L31