Result : EXP00127

Protein Information

• Protein name: EXP00127
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 2044489
• Right: 2044527
• Strand: +
• Nucleotide Sequence: ATGAAATTTAGTGTTGACAGACAAGGTACCGCTAAGTAA
• Sequence: MKFSVDRQGTAK
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2713193	2713231	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	2044489	2044527	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	2067470	2067508	+	NC_004337.2	Shigella flexneri 2a str. 301
4	2596687	2596725	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_004337.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF13495.8	0.67	2	1074.0	same-strand	Phage integrase, N-terminal SAM-like domain
2	PF06167.14	1.0	3	41.0	same-strand	Glucose-regulated metallo-peptidase M90
3	PF11924.10	0.67	2	384	same-strand	Inverse autotransporter, beta-domain
4	PF00665.28	0.67	2	1885	same-strand	Integrase core domain
5	PF13683.8	0.67	2	1885	same-strand	Integrase core domain
6	PF01527.22	0.67	2	2494	same-strand	Transposase