Result : EXP00125

Protein Information

• Protein name: EXP00125
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 272432
• Right: 272485
• Strand: +
• Nucleotide Sequence: ATGAACCCGTTAATCCGCCTCTGTGGGTTGAAAACGTCACCACGGCCTACGTGA
• Sequence: MNPLIRLCGLKTSPRPT
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 17

Conservation Analysis

No. of Species: 5

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	272432	272485	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	3074468	3074521	-	NC_004337.2	Shigella flexneri 2a str. 301
3	135238	135291	+	NZ_CP045203.1	Citrobacter telavivensis
4	5126644	5126697	-	NZ_CP040428.1	Jejubacter calystegiae
5	5365855	5365908	-	NZ_CP036175.1	Klebsiella huaxiensis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP045203.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF01527.22	0.8	4	648.0	same-strand	Transposase
2	PF00078.29	1.0	5	362	same-strand	Reverse transcriptase (RNA-dependent DNA polymerase)
3	PF13683.8	0.8	4	2062.0	same-strand	Integrase core domain
4	PF08388.13	0.6	3	377	same-strand	Group II intron, maturase-specific domain
5	PF13333.8	0.6	3	2062	same-strand	Integrase core domain