Result : EXP00124
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00124 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1720350 |
| Right | 1720415 |
| Strand | + |
| Nucleotide Sequence | TTGCGTGTGGTCAGGTTACTGACCACACGCCCCCTTCATTTCACCCTTTGGCCTGTAACTCAATGA |
| Sequence | LRVVRLLTTRPLHFTLWPVTQ |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2320213 | 2320278 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1720350 | 1720415 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1698452 | 1698517 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1903104 | 1903169 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00579.27 | 0.67 | 2 | 3128 | opposite-strand | tRNA synthetases class I (W and Y) |
| 2 | PF01479.27 | 0.67 | 2 | 3128 | opposite-strand | S4 domain |
| 3 | PF01243.22 | 0.67 | 2 | 2343 | opposite-strand | Pyridoxamine 5'-phosphate oxidase |
| 4 | PF10590.11 | 0.67 | 2 | 2343 | opposite-strand | Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region |
| 5 | PF09864.11 | 0.67 | 2 | 1961 | opposite-strand | Membrane-bound lysozyme-inhibitor of c-type lysozyme |
| 6 | PF03702.16 | 1.0 | 3 | 748.0 | opposite-strand | Anhydro-N-acetylmuramic acid kinase |
| 7 | PF05433.17 | 1.0 | 3 | 7.0 | same-strand | Glycine zipper 2TM domain |
| 8 | PF01047.24 | 1.0 | 3 | -25.0 | opposite-strand | MarR family |
| 9 | PF12802.9 | 1.0 | 3 | -25.0 | opposite-strand | MarR family |
| 10 | PF13463.8 | 1.0 | 3 | -25.0 | opposite-strand | Winged helix DNA-binding domain |
| 11 | PF07869.14 | 1.0 | 3 | 610.0 | same-strand | Protein of unknown function (DUF1656) |
| 12 | PF13533.8 | 1.0 | 3 | 849.0 | same-strand | Biotin-lipoyl like |
| 13 | PF00529.22 | 1.0 | 3 | 849.0 | same-strand | Cation efflux system protein CusB domain 1 |
| 14 | PF04632.14 | 1.0 | 3 | 1908.5 | same-strand | Fusaric acid resistance protein family |
++ More..