Result : EXP00122

Protein Information

• Protein name: EXP00122
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 1369632
• Right: 1369676
• Strand: +
• Nucleotide Sequence: TTGTTAAATCTCAGGCGTATAATGGATGGCAATTTTCATCCATAG
• Sequence: LLNLRRIMDGNFHP
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 14

Conservation Analysis

No. of Species: 4

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1369632	1369676	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	1363779	1363823	+	NC_004337.2	Shigella flexneri 2a str. 301
3	1840793	1840837	+	NZ_CP061527.1	Shigella dysenteriae
4	2368789	2368833	-	NZ_LR134340.1	Escherichia marmotae
5	1877588	1877632	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00158.28	1.0	4	1720.0	opposite-strand	Sigma-54 interaction domain
2	PF14532.8	1.0	4	1720.0	opposite-strand	Sigma-54 interaction domain
3	PF07728.16	1.0	4	1720	opposite-strand	AAA domain (dynein-related subfamily)
4	PF02954.21	1.0	4	1720	opposite-strand	Bacterial regulatory protein, Fis family
5	PF04012.14	1.0	4	885	same-strand	PspA/IM30 family
6	PF06667.14	1.0	4	607	same-strand	Phage shock protein B
7	PF04024.14	1.0	4	248	same-strand	PspC domain
8	PF09584.12	1.0	4	18	same-strand	Phage shock protein PspD (Phageshock PspD)