Result : EXP00121
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00121 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4486166 |
| Right | 4486216 |
| Strand | + |
| Nucleotide Sequence | ATGAAACAAGCTAAAATCCTGCAAAAGACGAGTTTTTACGGGCGTATTTAA |
| Sequence | MKQAKILQKTSFYGRI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5341884 | 5341934 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4531056 | 4531106 | + | NZ_AP014857.1 | Escherichia albertii |
| 3 | 4486166 | 4486216 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 4401380 | 4401430 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 522382 | 522432 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3971654 | 3971704 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 1180624 | 1180674 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 8 | 3511798 | 3511848 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 494289 | 494339 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 10 | 4160110 | 4160160 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 11 | 3297007 | 3297057 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 1926573 | 1926623 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 13 | 3311735 | 3311785 | + | NZ_CP033744.1 | Citrobacter freundii |
| 14 | 1790890 | 1790940 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 15 | 2795357 | 2795407 | - | NZ_CP038469.1 | Citrobacter tructae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00583.27 | 0.79 | 11 | 6585.0 | opposite-strand | Acetyltransferase (GNAT) family |
| 2 | PF13508.9 | 0.86 | 12 | 6589 | opposite-strand | Acetyltransferase (GNAT) domain |
| 3 | PF13302.9 | 0.86 | 12 | 6589 | opposite-strand | Acetyltransferase (GNAT) domain |
| 4 | PF00133.24 | 1.0 | 14 | 2298 | opposite-strand | tRNA synthetases class I (I, L, M and V) |
| 5 | PF08264.15 | 1.0 | 14 | 2298 | opposite-strand | Anticodon-binding domain of tRNA ligase |
| 6 | PF10458.11 | 1.0 | 14 | 2298 | opposite-strand | Valyl tRNA synthetase tRNA binding arm |
| 7 | PF04364.15 | 1.0 | 14 | 1847 | opposite-strand | DNA polymerase III chi subunit, HolC |
| 8 | PF00883.23 | 1.0 | 14 | 215 | opposite-strand | Cytosol aminopeptidase family, catalytic domain |
| 9 | PF02789.19 | 1.0 | 14 | 215 | opposite-strand | Cytosol aminopeptidase family, N-terminal domain |
| 10 | PF03739.16 | 1.0 | 14 | 598.5 | same-strand | Lipopolysaccharide export system permease LptF/LptG |
| 11 | PF05872.14 | 0.86 | 12 | 2303 | opposite-strand | Bacterial protein of unknown function (DUF853) |
| 12 | PF08240.14 | 0.71 | 10 | 3957.5 | opposite-strand | Alcohol dehydrogenase GroES-like domain |
| 13 | PF00107.28 | 0.71 | 10 | 3957.5 | opposite-strand | Zinc-binding dehydrogenase |
| 14 | PF13602.8 | 0.71 | 10 | 3957.5 | opposite-strand | Zinc-binding dehydrogenase |
++ More..