Result : EXP00119
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00119 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2483700 |
| Right | 2483774 |
| Strand | + |
| Nucleotide Sequence | ATGTCTGTATTACTACAGGGAGAAGGGAGATGCTTCATTGCAAAGGGAATAATCTATGAACGCAATAATTATTGA |
| Sequence | MSVLLQGEGRCFIAKGIIYERNNY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3211971 | 3212045 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2483700 | 2483774 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2486762 | 2486836 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3793287 | 3793361 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1246050 | 1246124 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 757030 | 757110 | + | NZ_CP036274.1 | Anatilimnocola aggregata |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00532.23 | 0.75 | 3 | 5019 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 2 | PF13377.8 | 0.75 | 3 | 5019 | opposite-strand | Periplasmic binding protein-like domain |
| 3 | PF00291.27 | 0.75 | 3 | 3170.0 | same-strand | Pyridoxal-phosphate dependent enzyme |
| 4 | PF07690.18 | 0.75 | 3 | 1524.0 | opposite-strand | Major Facilitator Superfamily |
| 5 | PF00529.22 | 0.75 | 3 | 361.0 | opposite-strand | Cation efflux system protein CusB domain 1 |
| 6 | PF13437.8 | 0.75 | 3 | 361.0 | opposite-strand | HlyD family secretion protein |
| 7 | PF13533.8 | 0.75 | 3 | 361.0 | opposite-strand | Biotin-lipoyl like |
| 8 | PF00072.26 | 0.75 | 3 | -19 | same-strand | Response regulator receiver domain |
| 9 | PF00196.21 | 0.75 | 3 | -19 | same-strand | Bacterial regulatory proteins, luxR family |
| 10 | PF00497.22 | 0.75 | 3 | 600.0 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 11 | PF02518.28 | 0.75 | 3 | 600.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 12 | PF00512.27 | 0.75 | 3 | 600.0 | same-strand | His Kinase A (phospho-acceptor) domain |
++ More..