Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00119 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 2483700 |
Right | 2483774 |
Strand | + |
Nucleotide Sequence | ATGTCTGTATTACTACAGGGAGAAGGGAGATGCTTCATTGCAAAGGGAATAATCTATGAACGCAATAATTATTGA |
Sequence | MSVLLQGEGRCFIAKGIIYERNNY |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3211971 | 3212045 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 2483700 | 2483774 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 2486762 | 2486836 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 3793287 | 3793361 | - | NZ_CP061527.1 | Shigella dysenteriae |
5 | 1246050 | 1246124 | - | NZ_CP061527.1 | Shigella dysenteriae |
6 | 757030 | 757110 | + | NZ_CP036274.1 | Anatilimnocola aggregata |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00532.23 | 0.75 | 3 | 5019 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
2 | PF13377.8 | 0.75 | 3 | 5019 | opposite-strand | Periplasmic binding protein-like domain |
3 | PF00291.27 | 0.75 | 3 | 3170.0 | same-strand | Pyridoxal-phosphate dependent enzyme |
4 | PF07690.18 | 0.75 | 3 | 1524.0 | opposite-strand | Major Facilitator Superfamily |
5 | PF00529.22 | 0.75 | 3 | 361.0 | opposite-strand | Cation efflux system protein CusB domain 1 |
6 | PF13437.8 | 0.75 | 3 | 361.0 | opposite-strand | HlyD family secretion protein |
7 | PF13533.8 | 0.75 | 3 | 361.0 | opposite-strand | Biotin-lipoyl like |
8 | PF00072.26 | 0.75 | 3 | -19 | same-strand | Response regulator receiver domain |
9 | PF00196.21 | 0.75 | 3 | -19 | same-strand | Bacterial regulatory proteins, luxR family |
10 | PF00497.22 | 0.75 | 3 | 600.0 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
11 | PF02518.28 | 0.75 | 3 | 600.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
12 | PF00512.27 | 0.75 | 3 | 600.0 | same-strand | His Kinase A (phospho-acceptor) domain |