Result : EXP00117
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00117 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1224165 |
| Right | 1224242 |
| Strand | + |
| Nucleotide Sequence | ATGAGGAGTATCAGCAAGAATACTCGCCGCTTTACCACAACGTGGATGAGAGGGATGAAAAACTCAAGGCAGAGATAA |
| Sequence | MRSISKNTRRFTTTWMRGMKNSRQR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1665790 | 1665867 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1224165 | 1224242 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1205281 | 1205358 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2486057 | 2486134 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00665.28 | 0.67 | 2 | 1807.0 | both-strands | Integrase core domain |
| 2 | PF13683.8 | 0.67 | 2 | 1807.0 | both-strands | Integrase core domain |
| 3 | PF03797.21 | 1.0 | 3 | 1088.0 | same-strand | Autotransporter beta-domain |
| 4 | PF03776.16 | 1.0 | 3 | 37.0 | opposite-strand | Septum formation topological specificity factor MinE |
| 5 | PF13614.8 | 1.0 | 3 | 307.0 | opposite-strand | AAA domain |
| 6 | PF01656.25 | 1.0 | 3 | 307.0 | opposite-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
| 7 | PF05209.15 | 1.0 | 3 | 1143.0 | opposite-strand | Septum formation inhibitor MinC, N-terminal domain |
| 8 | PF03775.18 | 1.0 | 3 | 1143.0 | opposite-strand | Septum formation inhibitor MinC, C-terminal domain |
| 9 | PF05666.13 | 1.0 | 3 | 2358.0 | same-strand | Fels-1 Prophage Protein-like |
| 10 | PF04151.17 | 0.67 | 2 | 2829 | opposite-strand | Bacterial pre-peptidase C-terminal domain |
| 11 | PF18883.2 | 0.67 | 2 | 2481.0 | same-strand | Autochaperone Domain Type 1 |
| 12 | PF16456.7 | 0.67 | 2 | 1531.5 | opposite-strand | YmgD protein |
| 13 | PF13441.8 | 0.67 | 2 | 1237.5 | opposite-strand | YMGG-like Gly-zipper |
| 14 | PF13488.8 | 0.67 | 2 | 1237.5 | opposite-strand | Glycine zipper |
| 15 | PF03212.16 | 0.67 | 2 | 1087.5 | same-strand | Pertactin |
++ More..