Result : EXP00116
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00116 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1902076 |
| Right | 1902123 |
| Strand | + |
| Nucleotide Sequence | ATGGTTGGGCTGCAGAGCAGTTGCTTAAAACGGCAGAAATGCTGTTAG |
| Sequence | MVGLQSSCLKRQKCC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2504042 | 2504089 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1902076 | 1902123 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1448176 | 1448223 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1817006 | 1817053 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1947993 | 1948040 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 244341 | 244388 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 1976636 | 1976683 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 554082 | 554129 | + | NZ_CP033744.1 | Citrobacter freundii |
| 9 | 1835001 | 1835048 | + | NZ_AP014857.1 | Escherichia albertii |
| 10 | 4529425 | 4529472 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 11 | 1359050 | 1359097 | + | NZ_CP038469.1 | Citrobacter tructae |
| 12 | 1125062 | 1125109 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 13 | 1928558 | 1928605 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 14 | 4439555 | 4439602 | + | NZ_CP053416.1 | Salmonella bongori |
| 15 | 1890301 | 1890348 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00293.30 | 0.93 | 13 | 5334.0 | same-strand | NUDIX domain |
| 2 | PF03313.17 | 0.93 | 13 | 3783.0 | same-strand | Serine dehydratase alpha chain |
| 3 | PF03315.17 | 0.93 | 13 | 3783.0 | same-strand | Serine dehydratase beta chain |
| 4 | PF00563.22 | 0.93 | 13 | 2051.5 | same-strand | EAL domain |
| 5 | PF12792.9 | 1.0 | 14 | 2052 | same-strand | CSS motif domain associated with EAL |
| 6 | PF03741.18 | 1.0 | 14 | 491 | opposite-strand | Integral membrane protein TerC family |
| 7 | PF03471.19 | 1.0 | 14 | 491 | opposite-strand | Transporter associated domain |
| 8 | PF03830.17 | 1.0 | 14 | -47 | same-strand | PTS system sorbose subfamily IIB component |
| 9 | PF03610.18 | 1.0 | 14 | -47 | same-strand | PTS system fructose IIA component |
| 10 | PF03609.16 | 1.0 | 14 | 951 | same-strand | PTS system sorbose-specific iic component |
| 11 | PF03613.16 | 1.0 | 14 | 1764 | same-strand | PTS system mannose/fructose/sorbose family IID component |
| 12 | PF06173.14 | 1.0 | 14 | 2677 | same-strand | Protein of unknown function (DUF986) |
| 13 | PF02659.17 | 0.79 | 11 | 3548.0 | same-strand | Putative manganese efflux pump |
++ More..