Result : EXP00114
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00114 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3658195 |
| Right | 3658275 |
| Strand | + |
| Nucleotide Sequence | ATGGAGTGCGTGATGGATAAATCTGAAGTATTGATTAGTGTTAATAGACGTATTAGTTCACGAAGGGTAAAGTTCTTATAG |
| Sequence | MECVMDKSEVLISVNRRISSRRVKFL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3658195 | 3658275 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4400455 | 4400535 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 3635251 | 3635331 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 334205 | 334285 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4151411 | 4151491 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3623235 | 3623315 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00196.21 | 1.0 | 5 | 91 | same-strand | Bacterial regulatory proteins, luxR family |
| 2 | PF06411.13 | 1.0 | 5 | 1835.5 | opposite-strand | HdeA/HdeB family |
| 3 | PF03729.15 | 1.0 | 5 | 628.0 | same-strand | Short repeat of unknown function (DUF308) |
| 4 | PF16576.7 | 1.0 | 5 | 957.0 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
| 5 | PF00529.22 | 0.8 | 4 | 957 | same-strand | Cation efflux system protein CusB domain 1 |
| 6 | PF13437.8 | 1.0 | 5 | 957.0 | same-strand | HlyD family secretion protein |
| 7 | PF13533.8 | 1.0 | 5 | 957.0 | same-strand | Biotin-lipoyl like |
| 8 | PF00873.21 | 0.8 | 4 | 2139 | same-strand | AcrB/AcrD/AcrF family |
| 9 | PF12833.9 | 0.6 | 3 | 5638.0 | opposite-strand | Helix-turn-helix domain |
| 10 | PF00005.29 | 0.6 | 3 | 2912 | same-strand | ABC transporter |
| 11 | PF13521.8 | 0.6 | 3 | 2912 | same-strand | AAA domain |
++ More..