Result : EXP00113
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00113 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 815568 |
| Right | 815651 |
| Strand | + |
| Nucleotide Sequence | ATGACAAACGGAAAACAGCCTGATGCGCTACGCTTATCAGGCCTACATTTTCTCCGCAATATATTGAATTTGCGCGGTTTGTAG |
| Sequence | MTNGKQPDALRLSGLHFLRNILNLRGL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 815568 | 815651 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1552092 | 1552184 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1552270 | 1552362 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 2538578 | 2538649 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 4470402 | 4470485 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 6 | 2549446 | 2549520 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 7 | 2945894 | 2945962 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 8 | 758395 | 758478 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 9 | 2535881 | 2535952 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 10 | 1785120 | 1785212 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 11 | 4416632 | 4416706 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 12 | 3243962 | 3244045 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 13 | 2906328 | 2906396 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 14 | 846495 | 846566 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 15 | 813543 | 813626 | + | NZ_AP014857.1 | Escherichia albertii |
| 16 | 1541716 | 1541799 | - | NZ_AP014857.1 | Escherichia albertii |
| 17 | 2522456 | 2522536 | + | NZ_AP014857.1 | Escherichia albertii |
| 18 | 4523581 | 4523667 | + | NZ_AP014857.1 | Escherichia albertii |
| 19 | 1460269 | 1460337 | + | NZ_LR134340.1 | Escherichia marmotae |
| 20 | 561503 | 561586 | + | NZ_LR134340.1 | Escherichia marmotae |
| 21 | 3585265 | 3585345 | - | NZ_LR134340.1 | Escherichia marmotae |
| 22 | 2208032 | 2208115 | + | NZ_LR134340.1 | Escherichia marmotae |
| 23 | 3083483 | 3083554 | - | NZ_LR134340.1 | Escherichia marmotae |
| 24 | 1476531 | 1476614 | + | NZ_LR134340.1 | Escherichia marmotae |
| 25 | 4252426 | 4252494 | + | NZ_LR134340.1 | Escherichia marmotae |
| 26 | 3429287 | 3429355 | + | NZ_LR134340.1 | Escherichia marmotae |
| 27 | 3671205 | 3671279 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 28 | 3990120 | 3990203 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 29 | 79086 | 79154 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 30 | 2136423 | 2136515 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 31 | 805415 | 805483 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 32 | 553091 | 553159 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 33 | 2073660 | 2073743 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 34 | 4944829 | 4944897 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 35 | 5326067 | 5326150 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 36 | 3991854 | 3991937 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 37 | 3668421 | 3668489 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 38 | 4281208 | 4281279 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 39 | 3294267 | 3294350 | - | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06968.15 | 0.67 | 4 | 5184.0 | same-strand | Biotin and Thiamin Synthesis associated domain |
| 2 | PF04055.23 | 0.83 | 5 | 2314.5 | same-strand | Radical SAM superfamily |
| 3 | PF00155.23 | 0.83 | 5 | 4033 | same-strand | Aminotransferase class I and II |
| 4 | PF08241.14 | 0.67 | 4 | 3291.0 | same-strand | Methyltransferase domain |
| 5 | PF13649.8 | 0.67 | 4 | 3291.0 | same-strand | Methyltransferase domain |
| 6 | PF13489.8 | 0.67 | 4 | 3291.0 | same-strand | Methyltransferase domain |
| 7 | PF08242.14 | 0.67 | 4 | 3291.0 | same-strand | Methyltransferase domain |
| 8 | PF13500.8 | 0.67 | 4 | 2621.0 | same-strand | AAA domain |
| 9 | PF01656.25 | 0.67 | 4 | 2621.0 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
| 10 | PF17757.3 | 0.67 | 4 | 21.0 | same-strand | UvrB interaction domain |
| 11 | PF12344.10 | 0.67 | 4 | 21.0 | same-strand | Ultra-violet resistance protein B |
| 12 | PF00271.33 | 0.67 | 4 | 21 | same-strand | Helicase conserved C-terminal domain |
| 13 | PF02151.21 | 0.67 | 4 | 21.0 | same-strand | UvrB/uvrC motif |
| 14 | PF01933.20 | 0.67 | 4 | 88.0 | opposite-strand | 2-phospho-L-lactate transferase CofD |
| 15 | PF06463.15 | 0.67 | 4 | 1393.0 | same-strand | Molybdenum Cofactor Synthesis C |
| 16 | PF00994.26 | 0.67 | 4 | 2404.0 | same-strand | Probable molybdopterin binding domain |
| 17 | PF01967.23 | 0.67 | 4 | 2919.0 | same-strand | MoaC family |
| 18 | PF02597.22 | 0.67 | 4 | 3397.0 | same-strand | ThiS family |
| 19 | PF00892.22 | 0.83 | 5 | 4955.5 | same-strand | EamA-like transporter family |
| 20 | PF04879.18 | 0.83 | 5 | 4112.5 | opposite-strand | Molybdopterin oxidoreductase Fe4S4 domain |
| 21 | PF01568.23 | 0.83 | 5 | 1652.5 | opposite-strand | Molydopterin dinucleotide binding domain |
| 22 | PF13247.8 | 0.83 | 5 | 755.5 | opposite-strand | 4Fe-4S dicluster domain |
| 23 | PF09163.13 | 0.83 | 5 | 755.5 | opposite-strand | Formate dehydrogenase N, transmembrane |
| 24 | PF12838.9 | 0.83 | 5 | 755.5 | opposite-strand | 4Fe-4S dicluster domain |
| 25 | PF13187.8 | 0.83 | 5 | 755.5 | opposite-strand | 4Fe-4S dicluster domain |
| 26 | PF13237.8 | 0.83 | 5 | 755.5 | opposite-strand | 4Fe-4S dicluster domain |
| 27 | PF12837.9 | 0.83 | 5 | 755.5 | opposite-strand | 4Fe-4S binding domain |
| 28 | PF14697.8 | 0.83 | 5 | 755.5 | opposite-strand | 4Fe-4S dicluster domain |
| 29 | PF01292.22 | 0.83 | 5 | 109.5 | opposite-strand | Prokaryotic cytochrome b561 |
| 30 | PF01381.24 | 0.83 | 5 | 35 | same-strand | Helix-turn-helix |
| 31 | PF08240.14 | 0.83 | 5 | 466 | same-strand | Alcohol dehydrogenase GroES-like domain |
| 32 | PF00107.28 | 0.83 | 5 | 466 | same-strand | Zinc-binding dehydrogenase |
| 33 | PF13602.8 | 0.83 | 5 | 466 | same-strand | Zinc-binding dehydrogenase |
| 34 | PF03949.17 | 0.83 | 5 | 1610 | same-strand | Malic enzyme, NAD binding domain |
| 35 | PF00390.21 | 0.67 | 4 | 1699.0 | same-strand | Malic enzyme, N-terminal domain |
| 36 | PF02896.20 | 0.67 | 4 | 2148 | opposite-strand | PEP-utilising enzyme, PEP-binding domain |
| 37 | PF05524.15 | 0.67 | 4 | 2148 | opposite-strand | PEP-utilising enzyme, N-terminal |
| 38 | PF00391.25 | 0.67 | 4 | 2148 | opposite-strand | PEP-utilising enzyme, mobile domain |
| 39 | PF00358.22 | 0.67 | 4 | 2236.5 | opposite-strand | phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 |
| 40 | PF17263.4 | 0.67 | 4 | 864.0 | opposite-strand | Family of unknown function (DUF5329) |
| 41 | PF00291.27 | 0.67 | 4 | 23.0 | same-strand | Pyridoxal-phosphate dependent enzyme |
| 42 | PF00005.29 | 0.67 | 4 | 1069 | same-strand | ABC transporter |
| 43 | PF02463.21 | 0.67 | 4 | 1068.0 | same-strand | RecF/RecN/SMC N terminal domain |
| 44 | PF00528.24 | 0.67 | 4 | 2155.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 45 | PF13531.8 | 0.67 | 4 | 3863.0 | same-strand | Bacterial extracellular solute-binding protein |
| 46 | PF01547.27 | 0.67 | 4 | 3863.0 | same-strand | Bacterial extracellular solute-binding protein |
| 47 | PF02378.20 | 0.67 | 4 | 4222.0 | same-strand | Phosphotransferase system, EIIC |
| 48 | PF00367.22 | 0.67 | 4 | 4222.0 | same-strand | phosphotransferase system, EIIB |
| 49 | PF02729.23 | 0.67 | 4 | 975 | same-strand | Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
| 50 | PF00185.26 | 0.67 | 4 | 975 | same-strand | Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
| 51 | PF13561.8 | 0.67 | 4 | 2855.5 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 52 | PF00106.27 | 0.67 | 4 | 2855.5 | same-strand | short chain dehydrogenase |
| 53 | PF13508.9 | 0.83 | 5 | 3170.0 | same-strand | Acetyltransferase (GNAT) domain |
| 54 | PF01520.20 | 0.83 | 5 | 1795 | opposite-strand | N-acetylmuramoyl-L-alanine amidase |
| 55 | PF03466.22 | 0.67 | 4 | 3327 | opposite-strand | LysR substrate binding domain |
| 56 | PF00126.29 | 0.67 | 4 | 3327 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 57 | PF06004.14 | 0.67 | 4 | 2749 | opposite-strand | Bacterial protein of unknown function (DUF903) |
| 58 | PF00266.21 | 0.67 | 4 | 1352 | same-strand | Aminotransferase class-V |
| 59 | PF02657.17 | 0.67 | 4 | 909 | same-strand | Fe-S metabolism associated domain |
| 60 | PF00899.23 | 0.67 | 4 | 52 | opposite-strand | ThiF family |
| 61 | PF03562.19 | 0.67 | 4 | 119 | opposite-strand | MltA specific insert domain |
| 62 | PF06725.13 | 0.67 | 4 | 119 | opposite-strand | 3D domain |
| 63 | PF11741.10 | 0.67 | 4 | 1795 | opposite-strand | AMIN domain |
| 64 | PF00696.30 | 0.67 | 4 | 3280.0 | same-strand | Amino acid kinase family |
| 65 | PF13245.8 | 0.67 | 4 | 5774.0 | opposite-strand | AAA domain |
| 66 | PF05127.16 | 0.67 | 4 | 4673 | opposite-strand | Helicase |
| 67 | PF13538.8 | 0.67 | 4 | 4673 | opposite-strand | UvrD-like helicase C-terminal domain |
| 68 | PF13401.8 | 0.67 | 4 | 4673 | opposite-strand | AAA domain |
| 69 | PF00580.23 | 0.67 | 4 | 6499 | opposite-strand | UvrD/REP helicase N-terminal domain |
| 70 | PF13361.8 | 0.67 | 4 | 6444.0 | opposite-strand | UvrD-like helicase C-terminal domain |
++ More..