Result : EXP00109
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00109 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2596839 |
| Right | 2596892 |
| Strand | + |
| Nucleotide Sequence | ATGCATATATTCCGAGAGCGGTTGTCTTGCCGTGCCAGCTGCACGGCAAGATGA |
| Sequence | MHIFRERLSCRASCTAR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2596839 | 2596892 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2584896 | 2584949 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 3313069 | 3313122 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 1151225 | 1151278 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01546.30 | 0.67 | 2 | 4105 | same-strand | Peptidase family M20/M25/M40 |
| 2 | PF07687.16 | 0.67 | 2 | 4105 | same-strand | Peptidase dimerisation domain |
| 3 | PF13980.8 | 0.67 | 2 | 3877 | same-strand | Uncharacterised protein family (UPF0370) |
| 4 | PF02230.18 | 0.67 | 2 | 3069 | opposite-strand | Phospholipase/Carboxylesterase |
| 5 | PF05127.16 | 1.0 | 3 | 980.0 | opposite-strand | Helicase |
| 6 | PF17176.6 | 1.0 | 3 | 980.0 | opposite-strand | tRNA-binding domain |
| 7 | PF08351.13 | 1.0 | 3 | 980.0 | opposite-strand | Domain of unknown function (DUF1726) |
| 8 | PF04228.15 | 0.67 | 2 | 102 | opposite-strand | Putative neutral zinc metallopeptidase |
| 9 | PF01259.20 | 1.0 | 3 | 13.0 | opposite-strand | SAICAR synthetase |
| 10 | PF06804.13 | 1.0 | 3 | 939.0 | opposite-strand | NlpB/DapX lipoprotein |
| 11 | PF00701.24 | 1.0 | 3 | 1990.0 | opposite-strand | Dihydrodipicolinate synthetase family |
| 12 | PF13740.8 | 1.0 | 3 | 3014.0 | same-strand | ACT domain |
| 13 | PF01842.27 | 1.0 | 3 | 3014.0 | same-strand | ACT domain |
++ More..