Result : EXP00108
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00108 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2876401 |
| Right | 2876442 |
| Strand | + |
| Nucleotide Sequence | ATGAAATTACCAATTAGAATGAGTAGTTCCTTAACGGAATAA |
| Sequence | MKLPIRMSSSLTE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2815819 | 2815860 | + | NZ_AP014857.1 | Escherichia albertii |
| 2 | 877780 | 877821 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 3369001 | 3369042 | + | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 3597051 | 3597092 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 2876401 | 2876442 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 6 | 2848537 | 2848578 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04977.17 | 1.0 | 5 | 3581.0 | opposite-strand | Septum formation initiator |
| 2 | PF12084.10 | 1.0 | 5 | 3064.0 | opposite-strand | Protein of unknown function (DUF3561) |
| 3 | PF01583.22 | 1.0 | 5 | 2409.0 | opposite-strand | Adenylylsulphate kinase |
| 4 | PF00009.29 | 1.0 | 5 | 982.0 | opposite-strand | Elongation factor Tu GTP binding domain |
| 5 | PF01507.21 | 1.0 | 5 | 73 | opposite-strand | Phosphoadenosine phosphosulfate reductase family |
| 6 | PF04389.19 | 1.0 | 5 | 139.0 | same-strand | Peptidase family M28 |
| 7 | PF01848.18 | 0.6 | 3 | 1302 | opposite-strand | Hok/gef family |
| 8 | PF01077.24 | 0.6 | 3 | 2632 | opposite-strand | Nitrite and sulphite reductase 4Fe-4S domain |
| 9 | PF03460.19 | 0.6 | 3 | 2632 | opposite-strand | Nitrite/Sulfite reductase ferredoxin-like half domain |
| 10 | PF13671.8 | 0.8 | 4 | 2409 | opposite-strand | AAA domain |
++ More..