Result : EXP00107

Protein Information

• Protein name: EXP00107
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 1311711
• Right: 1311767
• Strand: +
• Nucleotide Sequence: ATGCGATGCGCAGATGGCGTTATGAGCCGGGTAAGCCAGGCAGTGGGATTGTGGTGA
• Sequence: MRCADGVMSRVSQAVGLW
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 18

Conservation Analysis

No. of Species: 5

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1754693	1754749	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	1311711	1311767	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	1308033	1308089	+	NC_004337.2	Shigella flexneri 2a str. 301
4	2383502	2383558	-	NZ_CP061527.1	Shigella dysenteriae
5	1864367	1864423	-	NC_013716.1	Citrobacter rodentium ICC168
6	1182840	1182893	+	NC_010168.1	Renibacterium salmoninarum ATCC 33209

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF03795.16	0.6	3	846.0	opposite-strand	YCII-related domain
2	PF16031.7	0.8	4	-56	same-strand	TonB polyproline region
3	PF03544.16	0.8	4	-56	same-strand	Gram-negative bacterial TonB protein C-terminal
4	PF03061.24	0.8	4	81	opposite-strand	Thioesterase superfamily
5	PF04279.17	0.6	3	584.0	opposite-strand	Intracellular septation protein A
6	PF06790.13	0.6	3	1153.0	opposite-strand	Uncharacterised protein family (UPF0259)
7	PF03922.16	0.6	3	2253.0	same-strand	OmpW family
8	PF13505.8	0.6	3	2253.0	same-strand	Outer membrane protein beta-barrel domain