Result : EXP00101
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00101 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1295284 |
| Right | 1295370 |
| Strand | + |
| Nucleotide Sequence | ATGGTCACTGAAATCGAGCAGATCATTGAGAAGTGGCATAAGAAAACGGCTCCCTGTTGTGGAAGCCGTTATAGTGCCTCAGTTTAA |
| Sequence | MVTEIEQIIEKWHKKTAPCCGSRYSASV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1295284 | 1295370 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4956055 | 4956141 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 3 | 897095 | 897181 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 4 | 1229768 | 1229854 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 5 | 2015904 | 2015990 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 6 | 2398899 | 2398985 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 2670406 | 2670492 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 1861607 | 1861693 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 4248589 | 4248675 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 10 | 4409500 | 4409586 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 11 | 4495398 | 4495484 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 12 | 312106 | 312192 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 13 | 4599794 | 4599895 | + | NZ_CP007230.1 | Yersinia similis |
| 14 | 2029065 | 2029148 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..